ID: 1079591129

View in Genome Browser
Species Human (GRCh38)
Location 11:22184075-22184097
Sequence ATTGACTGAGTGGTTACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079591129_1079591131 12 Left 1079591129 11:22184075-22184097 CCAGATGTAACCACTCAGTCAAT No data
Right 1079591131 11:22184110-22184132 TTTCACTCTCTTTGTACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079591129 Original CRISPR ATTGACTGAGTGGTTACATC TGG (reversed) Intergenic