ID: 1079591129 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:22184075-22184097 |
| Sequence | ATTGACTGAGTGGTTACATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1079591129_1079591131 | 12 | Left | 1079591129 | 11:22184075-22184097 | CCAGATGTAACCACTCAGTCAAT | No data | ||
| Right | 1079591131 | 11:22184110-22184132 | TTTCACTCTCTTTGTACTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1079591129 | Original CRISPR | ATTGACTGAGTGGTTACATC TGG (reversed) | Intergenic | ||