ID: 1079601746

View in Genome Browser
Species Human (GRCh38)
Location 11:22317941-22317963
Sequence CAGCCAGCAGCAGTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079601740_1079601746 13 Left 1079601740 11:22317905-22317927 CCGGAGGGATGGAAGTCAGTGGC No data
Right 1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG No data
1079601738_1079601746 19 Left 1079601738 11:22317899-22317921 CCGCATCCGGAGGGATGGAAGTC No data
Right 1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG No data
1079601735_1079601746 24 Left 1079601735 11:22317894-22317916 CCCTGCCGCATCCGGAGGGATGG No data
Right 1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG No data
1079601737_1079601746 23 Left 1079601737 11:22317895-22317917 CCTGCCGCATCCGGAGGGATGGA No data
Right 1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079601746 Original CRISPR CAGCCAGCAGCAGTGGTGCA GGG Intergenic
No off target data available for this crispr