ID: 1079603786

View in Genome Browser
Species Human (GRCh38)
Location 11:22341856-22341878
Sequence CCTCTCAGTGGCGGGGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079603786_1079603797 9 Left 1079603786 11:22341856-22341878 CCCGTTCCCCCGCCACTGAGAGG 0: 1
1: 0
2: 0
3: 18
4: 147
Right 1079603797 11:22341888-22341910 GTGCTCCCTAAGCTCCTCTCTGG 0: 1
1: 0
2: 0
3: 21
4: 145
1079603786_1079603801 28 Left 1079603786 11:22341856-22341878 CCCGTTCCCCCGCCACTGAGAGG 0: 1
1: 0
2: 0
3: 18
4: 147
Right 1079603801 11:22341907-22341929 CTGGCTCTGCCGTTCTAGAATGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079603786 Original CRISPR CCTCTCAGTGGCGGGGGAAC GGG (reversed) Intronic
903322843 1:22553062-22553084 CCTCTGGGTGGCGGGGGCAAGGG - Intergenic
903606085 1:24576170-24576192 CCTTTCTGTGGCTGGGAAACTGG - Intronic
903682943 1:25109177-25109199 ACTCTCAGTGATGGGGGAAAAGG - Intergenic
904883581 1:33718933-33718955 CTTCTCAGTTGCCTGGGAACAGG - Intronic
904917256 1:33979185-33979207 CATCTCACTGGCAGGGGATCTGG - Intronic
905797115 1:40822167-40822189 CCTGTCAGTGGCTGTGGAATTGG + Intronic
906345453 1:45011707-45011729 CCTGTCAGTGGCAGGGGAAGGGG - Intergenic
907420476 1:54343520-54343542 CCACCCAGTGGCAGGGGAGCAGG + Intronic
912378903 1:109235871-109235893 CCTCCCAGTGGTGTGGAAACAGG + Intronic
915255747 1:154627469-154627491 ACTCTCCGAGGCGGGGGAGCCGG + Intronic
915732011 1:158060521-158060543 AGTCTCAGTGGAGGCGGAACAGG - Intronic
921527986 1:216241788-216241810 CCTCTCAGTGCTGGGGTTACAGG + Intronic
923911106 1:238444923-238444945 GCTCTCAGTGGGAGGGGAGCTGG - Intergenic
1063624504 10:7676573-7676595 TCTCTCAGTGGTGGGGGAATGGG - Intergenic
1065009369 10:21407698-21407720 GCTCTCAGTGGAAGGGGAGCTGG + Intergenic
1066522584 10:36238711-36238733 CATCTCAGTGGCAGGGGTAGGGG + Intergenic
1068318844 10:55383123-55383145 GCTCTCAGTGGAAGGGGAGCTGG + Intronic
1068460716 10:57324728-57324750 CCTGTCAGGGGCTGGGGGACTGG + Intergenic
1068936262 10:62638409-62638431 ACTCTCAGTGGCGGGGGATGGGG + Intronic
1069631124 10:69897554-69897576 CCTCTCAGTGGAGAGGGGCCCGG - Intronic
1074185830 10:111098775-111098797 CCTCTCAGTCCAGGGAGAACTGG + Intergenic
1074411235 10:113230402-113230424 CCTCTCAGTAGGGGGGGGCCTGG + Intergenic
1074866596 10:117547534-117547556 CCTCTTCGTGGCGGGGGCCCTGG - Intronic
1076734941 10:132454618-132454640 CCTCTCAGGGGAGAGGGCACAGG + Intergenic
1077328967 11:1975697-1975719 TGTCTCAGTGGCGGGGGATAGGG + Intronic
1077540520 11:3144552-3144574 TGTCTCAGTGTCGGTGGAACGGG - Intronic
1077635829 11:3840901-3840923 CCTCCCCGAGGCGGGGGAGCTGG + Exonic
1079603786 11:22341856-22341878 CCTCTCAGTGGCGGGGGAACGGG - Intronic
1079687774 11:23382638-23382660 CCTGTCAGGGGTGGGGGAAGGGG + Intergenic
1084950866 11:72664781-72664803 CCTCTCAGTGAGGGGGGATCTGG - Intronic
1202811946 11_KI270721v1_random:30876-30898 TGTCTCAGTGGCGGGGGATAGGG + Intergenic
1101239472 12:102824053-102824075 CCTACCAGTGGCTGGGGAAAGGG + Intergenic
1101372028 12:104138546-104138568 CCTCCACGTGGCGGGGGAAGGGG - Intergenic
1103476732 12:121224090-121224112 CATCTCTGTGGCTGGGGAATGGG + Intronic
1103942037 12:124506429-124506451 CTTCGCCGTGGCGGGGGAGCAGG - Intronic
1106308697 13:28534695-28534717 CCTCTGAGTGCCGGGGCCACAGG + Intergenic
1106848061 13:33759034-33759056 TCTCTCATTGGCGGGTGAAGAGG - Intergenic
1109304550 13:60624296-60624318 GCACTCAGTGGCAGGGAAACAGG - Intergenic
1111337965 13:86846923-86846945 CCTCTCAGTGGCAGTGGCAGAGG - Intergenic
1113480415 13:110616018-110616040 CCGCGCGGTGGCCGGGGAACGGG + Intronic
1118729543 14:68656710-68656732 CCTCTCAGGGGTGGGGGACCTGG - Intronic
1118797217 14:69153646-69153668 CCTGCCCGAGGCGGGGGAACCGG + Intergenic
1120577255 14:86198615-86198637 CCTGTCAGGGGGTGGGGAACGGG - Intergenic
1120614693 14:86688825-86688847 GCTCTCAGTGGAAGGGGAGCTGG - Intergenic
1122281131 14:100623040-100623062 CATCTGAGTGGTGGGGGCACCGG + Intergenic
1126850183 15:52791684-52791706 CCTCTCAGAGCCGGGGTATCTGG + Intergenic
1130224912 15:82048836-82048858 CCTCTCTGTGGAGGGTGACCTGG - Intergenic
1132067609 15:98744950-98744972 CCTCTCAGAGGCAGCAGAACAGG - Intronic
1133801782 16:9091126-9091148 CCTCTCAGTGCCCGCGGCACAGG + Intergenic
1133994853 16:10740452-10740474 CCTTTAAGTGGCAGGGGAGCTGG + Intergenic
1134602326 16:15543107-15543129 GCTCTCAGTGGAAGGGGAGCTGG + Intronic
1139429551 16:66903883-66903905 CCTCCCAGTGGCGGTGGCAGTGG - Intergenic
1141972538 16:87493067-87493089 CCAATCAGTGGGGGGGGGACGGG - Intergenic
1142031153 16:87839205-87839227 CCTCCCAGGGCTGGGGGAACAGG - Intronic
1142360859 16:89626073-89626095 CCTCACAGTGGCGGGAGGACGGG - Intronic
1142476164 17:191608-191630 TGTCGCAGGGGCGGGGGAACGGG - Intergenic
1143513463 17:7408057-7408079 CCTCTCCATGGAGGGGGCACGGG - Intronic
1146540008 17:33685929-33685951 GCTCTCAGTCACGGGGGACCGGG + Intronic
1149524648 17:57345371-57345393 CCTCTCAGGGGTTGGGAAACAGG - Intronic
1149651399 17:58278626-58278648 CCTCTCAGTGGGGCGGAAACAGG + Intronic
1151304713 17:73255892-73255914 CCTTTCAGAGACGGGGGTACTGG + Intronic
1151533197 17:74720877-74720899 GCTCTCAGTGGAAGGGGAGCTGG + Intronic
1152226250 17:79094255-79094277 CCTCTCAGTTGCGGGGAAGCAGG - Intronic
1154255404 18:12777410-12777432 CCTCTCAGTTTCAGGGCAACAGG + Intergenic
1156244434 18:35284290-35284312 CCCCTGACTGGAGGGGGAACTGG - Intronic
1156864430 18:41873194-41873216 CCTTTAAGTGGGGAGGGAACAGG - Intergenic
1157958594 18:52126677-52126699 GCTCTCAGTGGAAGGGGAGCTGG - Intergenic
1158393514 18:57062353-57062375 CCTCTCAGTGGAGGGTGAAGGGG - Intergenic
1160786689 19:903401-903423 CCACTCAGTGTGGGGGGAATAGG + Intronic
1160800139 19:963849-963871 CCTGTCAGTGTGGAGGGAACAGG + Intronic
1161029525 19:2051217-2051239 CCTCTCAGCGGCGGTGGCCCAGG - Exonic
1161750048 19:6089309-6089331 CATCTCAGTGGCGGAGGATGTGG + Intronic
1161824266 19:6551846-6551868 CCCCTGAGTGCCGGGGCAACAGG - Intergenic
1162320090 19:9966506-9966528 CATCCAAGTGGCGGGGGGACCGG + Intronic
1163775851 19:19217004-19217026 GCTCTTTGTGGCTGGGGAACAGG + Exonic
1163807237 19:19406402-19406424 CCGCTCAGGGGCGGGGGTCCGGG + Intronic
1164203774 19:23040954-23040976 TCTCTCAGTGGCTGGTGAAATGG - Intergenic
1165065177 19:33224571-33224593 GCTCTCACTGGCAGGGGACCGGG + Intronic
1166363784 19:42268540-42268562 CCTCTCAGTGGCAGCGGTAGCGG - Intronic
1167758940 19:51431364-51431386 CGTATCAGAGGCTGGGGAACAGG - Intergenic
1168233025 19:55045229-55045251 CCTGGCCGTGGCGGAGGAACTGG - Exonic
925117259 2:1390166-1390188 CCTGTCAGAGGCTGGGGAGCTGG - Intronic
928880946 2:36095799-36095821 CCTGCCAGTGGCGGGGAAAGAGG + Intergenic
929646439 2:43633276-43633298 CCTCCCAGTGGGGGTGGACCAGG - Intergenic
931287261 2:60843024-60843046 CCTCTAGGTGGTGGGGGGACAGG - Intergenic
931635594 2:64338343-64338365 GCTCTCAGTGTGGAGGGAACTGG - Intergenic
932699559 2:73984182-73984204 CCTCCCAGAGGAGGGGGAACGGG - Intergenic
935284404 2:101551251-101551273 CCTTTCAGTGTCAGGGGCACTGG - Intergenic
935374928 2:102386211-102386233 CCTGTCATTGGTGGGGGAAGTGG + Intronic
936697157 2:114964765-114964787 CCTCTCAGTGTGGGAGAAACAGG + Intronic
937288448 2:120767637-120767659 CCTCTCAGAGCGGGGGGCACAGG - Intronic
938601743 2:132849560-132849582 CATCTCTGTGGCAGGGGAACAGG - Intronic
939491439 2:142882008-142882030 CCTCCCAGTGCTGGGGTAACAGG + Intronic
940987666 2:160064395-160064417 CCTCTCACTGGCTGTGGACCAGG + Intergenic
941203333 2:162541682-162541704 CCTGTAAGAGGCGGGGGATCGGG + Intronic
946044429 2:216809933-216809955 CCTCTGTGTGACGGGGGCACAGG - Intergenic
946537511 2:220647480-220647502 CACGTCAGTGGCGGGGGAGCTGG + Intergenic
1168903070 20:1382122-1382144 CCTCTCTTTGGGGAGGGAACAGG + Intronic
1174383162 20:50170628-50170650 CCTCCCAGTGGCGGGATTACAGG + Intergenic
1180137851 21:45872656-45872678 CCACACAGTGGCAGGGGCACTGG - Intronic
1180629588 22:17219215-17219237 ACTCTCAGTGGAGGAGTAACAGG - Intronic
1181828704 22:25541173-25541195 CCTTTTAGTGGAGAGGGAACAGG + Intergenic
1181859180 22:25805106-25805128 GCTCTCAGTGGGGATGGAACTGG + Intronic
1182118833 22:27774000-27774022 CCTCTCAGTGGTAGGGGCTCAGG + Intronic
1183324648 22:37184684-37184706 CCGCTGAGTGGAGTGGGAACAGG - Intronic
1185089012 22:48755611-48755633 CCTCCCAGGAGCGGGGGGACAGG - Intronic
950442597 3:13018717-13018739 CATCTCACAGGCGGGGAAACAGG + Intronic
950965088 3:17140432-17140454 TCTCTCATTGGCGGCTGAACAGG - Intergenic
951053538 3:18121627-18121649 CTTCTCAGTGACGGGGGCAGAGG + Intronic
959520375 3:107317469-107317491 CCTCACAGTGGCGGGGGACAAGG - Intergenic
960986997 3:123287244-123287266 CAGCTCAGAGGCGGGGGAGCAGG - Intronic
963038702 3:141052888-141052910 CCTCTGACTGGCGGGAGAACCGG + Intronic
963546886 3:146671440-146671462 CCTCTAAGGGGTGGGGGAAAGGG - Intergenic
967382485 3:188874489-188874511 CTTCTCAGTGCCGGCTGAACAGG - Exonic
969365669 4:6692894-6692916 CCTCTCAGAGGAGGAGGAGCTGG - Intergenic
979881091 4:125961451-125961473 GCTCTCAGTGGAGAGGGGACAGG - Intergenic
984462950 4:180058956-180058978 CCTCTCAGAGGCGCGCGAGCGGG - Intergenic
984490765 4:180431760-180431782 CTCCTCTGTGGCGGGGGAACGGG + Intergenic
989181843 5:38586055-38586077 TGTCTCAGTGGCTGGGGAAGTGG - Intronic
989384691 5:40843672-40843694 CCTTTCATTGGAGGAGGAACAGG + Exonic
992734452 5:79704809-79704831 CCTCCCAGTGAAGGGGAAACAGG - Intronic
994433223 5:99695354-99695376 ACTCTCAGTGGAAGGGGAGCTGG + Intergenic
999246168 5:150155889-150155911 CCCCAAAGTGGCGGGGGAAGTGG - Intergenic
1000160853 5:158596302-158596324 TCTTTCAGTGGCTGGGGAAAGGG - Intergenic
1002374950 5:178782060-178782082 CCTCTCAGGAGCTGGGGACCAGG + Intergenic
1002813401 6:656590-656612 CCTCACGGTGGCGGTGGAGCTGG - Exonic
1003485869 6:6579341-6579363 CCTCTGTGGGGCAGGGGAACTGG - Intergenic
1006594849 6:35185557-35185579 CCTCCCAGTGGCGGGACCACGGG + Intergenic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1006861102 6:37171798-37171820 CCTTTTACTGGCGGGGAAACTGG - Intronic
1007114034 6:39330654-39330676 CCTCTCAGTGTGGGTGAAACTGG + Exonic
1007809565 6:44476349-44476371 CCTCTGAGTGGTGGGTGAAGAGG + Intergenic
1013888310 6:114998170-114998192 CCACACAGTGGAAGGGGAACTGG - Intergenic
1014560085 6:122879455-122879477 CCTGTCAGTGGTGGGGGGAAGGG - Intergenic
1019553945 7:1619471-1619493 CGTCTGAGCGGCGGGGGAGCCGG + Intergenic
1020492908 7:8811395-8811417 CCTCTGAGTGGTGGGGGAGCTGG + Intergenic
1020777252 7:12470524-12470546 GCACTCAGTGGTGGGTGAACTGG + Intergenic
1021798730 7:24284066-24284088 CCCCTGAGTGGCGGGGGGAGGGG - Intergenic
1026549908 7:71359287-71359309 CCTCTCAGAGGAGGGTGAAGAGG + Intronic
1026828341 7:73597219-73597241 CCCCGCAGTGGTGGGGGGACTGG + Exonic
1029001222 7:97156969-97156991 CCTGTCAGGGGCTGGGGGACTGG - Intronic
1034271480 7:149805393-149805415 CACCTCTGTGGAGGGGGAACAGG - Intergenic
1034369401 7:150581833-150581855 CCTCTCAGTGGCTGGGGACAAGG - Intergenic
1038010175 8:23469327-23469349 CCTCTCAGCAGCTGGGGGACAGG + Intergenic
1044523242 8:93223869-93223891 CCTCTCAGTGGGTGGGGGGCGGG - Intergenic
1045724891 8:105160770-105160792 CCTGTCAGTGGCGGGGGCAAGGG - Intronic
1048029288 8:130615770-130615792 CCTCCAAGTGGCGGGGAAAATGG + Intergenic
1048721879 8:137334924-137334946 CCTCTCAGCAGCAGCGGAACTGG + Intergenic
1049220762 8:141427810-141427832 CCACTCACTGGCGGATGAACTGG - Exonic
1049407027 8:142456140-142456162 GCTCTCTGGGGCTGGGGAACAGG - Intronic
1052827286 9:33186341-33186363 CCTCTCAGTTCTGGGGAAACTGG + Intergenic
1053346912 9:37384838-37384860 CCTCTGAGTGACGGTGGAGCTGG - Intergenic
1059698043 9:116747518-116747540 CCTGCCAGAGGTGGGGGAACTGG + Intronic
1061074222 9:128331408-128331430 CCTCTCTGTGGTGGGGGGAAGGG + Intronic
1185646282 X:1618029-1618051 CGTATCAGTGGCTGGGGAATAGG - Intronic
1187105732 X:16239609-16239631 CTTATCAGTGGGGGAGGAACTGG + Intergenic
1188911580 X:35854427-35854449 CCTCTCAGTGGTTGGGGGAGGGG + Intergenic
1189215212 X:39317141-39317163 CCTCTCAGTTGCTGAGGAAAAGG - Intergenic
1190303080 X:49067579-49067601 CCCCGCAGTGGCGGTGGAACAGG + Exonic
1193590432 X:83382963-83382985 CCTCTCAGGGGGTGGGGAGCTGG + Intergenic
1195972036 X:110483440-110483462 CCTGTCGGTGGGTGGGGAACTGG + Intergenic
1196794798 X:119493543-119493565 CCTGTGGGTGGCGAGGGAACAGG - Intergenic
1197931079 X:131697006-131697028 CCTGTCAGTGGTGGGGGACTAGG - Intergenic
1198314840 X:135454981-135455003 CTTCTCTCTGGCGGGGGAAAAGG - Intergenic
1199780802 X:151057586-151057608 CCTGTCAGGGGCTGGGGGACTGG - Intergenic
1202190506 Y:22238666-22238688 CCTGTCAGTGGTGGGGGATAGGG - Intergenic