ID: 1079604100

View in Genome Browser
Species Human (GRCh38)
Location 11:22343656-22343678
Sequence GCTGAGGGCAGACCGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 444}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079604100 Original CRISPR GCTGAGGGCAGACCGGGAGC AGG Intronic
900346081 1:2210829-2210851 GCTGAGGGCAGACTGCAGGCTGG + Intronic
900388050 1:2419564-2419586 GGTGAGGGCGGAAGGGGAGCAGG + Intergenic
900395239 1:2450699-2450721 GCGGGGGGCAGGCGGGGAGCGGG - Intronic
900501655 1:3008631-3008653 GCAGAGGGCAAAGGGGGAGCAGG - Intergenic
900579761 1:3403185-3403207 GCTGCGGGCAGAGCAGGTGCAGG + Intronic
900646811 1:3712815-3712837 GCAGAGGGCAGAGCCGGACCTGG + Intronic
900860629 1:5226678-5226700 GCTGAGGGGAGGTAGGGAGCTGG + Intergenic
905125849 1:35715882-35715904 ACTGAGGGCAGAAGGGGATCGGG + Exonic
905359867 1:37411771-37411793 GCAGAAGGCAGAGGGGGAGCTGG - Intergenic
905556443 1:38888968-38888990 GATGAGGTCAGACAGGTAGCAGG + Intronic
905651326 1:39659002-39659024 GATGAGGGCAGACAGGCAGAAGG + Intergenic
905886168 1:41493331-41493353 AGTGAGGTCAGACAGGGAGCTGG + Intergenic
905913422 1:41669272-41669294 GCTGAGGGGAGACCTGGGGAGGG + Intronic
905928886 1:41772279-41772301 GCTGAGAGGAGAACGAGAGCTGG + Intronic
906119929 1:43382620-43382642 GCTCAGGGCAGAGCTGGAGAGGG + Intergenic
906196702 1:43934361-43934383 GCTAGGGGGAGCCCGGGAGCAGG - Intronic
906250276 1:44305743-44305765 GCTGAGGGGAGAAGGGGAGGAGG + Intronic
906315630 1:44784838-44784860 GCTGAGAGCTGACCGGGAGAGGG + Intronic
906637322 1:47417799-47417821 GCTGAGGGCAGACAGGTAAGTGG - Exonic
906790944 1:48658464-48658486 GCTGAGGGCAGACAGGGGTCTGG - Intronic
908815011 1:68022820-68022842 GATGAGGACAGGCCAGGAGCTGG - Intergenic
909716867 1:78718663-78718685 TCTGAGACCAGACCAGGAGCAGG - Intergenic
911172602 1:94784904-94784926 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
911643956 1:100319238-100319260 GCTGAAGGCAAAGGGGGAGCAGG - Intergenic
911771495 1:101748308-101748330 GCTGTTGGCAGACCAGAAGCTGG + Intergenic
914806487 1:150995790-150995812 GGTGAGGGGAGACCTGGAGTGGG - Intergenic
915218108 1:154353248-154353270 GCTGAGGGCAGGGTGGGAGGCGG - Intergenic
915268138 1:154733199-154733221 GCTGTGGGCAAACCTAGAGCGGG + Intronic
915294994 1:154914003-154914025 GCTGAAGGCAAAGGGGGAGCAGG - Intergenic
915782495 1:158568160-158568182 AGGGAGGGCAGACTGGGAGCAGG - Intergenic
916179274 1:162069991-162070013 GCCGAGGGCCGAGCGGCAGCGGG - Exonic
917784706 1:178441943-178441965 GCAGAAGGCAGAAGGGGAGCAGG + Intronic
918040054 1:180908423-180908445 GATGAGGGCAGGCCTGGGGCTGG + Intergenic
919958172 1:202439313-202439335 CCTGAGGGCAGCCCTGAAGCTGG + Intronic
920944110 1:210512203-210512225 GCTCAGGGCAGACCCAGAGATGG + Intronic
921091619 1:211848850-211848872 GGTGAGGGCAAAAGGGGAGCAGG - Intergenic
921762899 1:218937429-218937451 GCTGCGGGCTGAGTGGGAGCTGG - Intergenic
922640692 1:227228121-227228143 GGTGGGGGCAGGCCGGGAGAGGG + Intronic
922872921 1:228917612-228917634 GGTAAGGGCAGGCAGGGAGCTGG + Intergenic
923035048 1:230279808-230279830 GCTGAGGACAGGGCGGGAGGAGG + Exonic
923242831 1:232102308-232102330 GCAGAAGGCAAAACGGGAGCAGG - Intergenic
924585403 1:245357096-245357118 GCTGAGGGCAGAGAGGGACCAGG + Intronic
1063112002 10:3046025-3046047 GGGGAGGGCAGCCCTGGAGCGGG + Intergenic
1064172596 10:13047325-13047347 GCTGGTGACAGACCGGCAGCTGG + Intronic
1064423053 10:15206644-15206666 GCAGAAGGCAGAGCAGGAGCAGG - Intergenic
1065444100 10:25780007-25780029 GCTGAAGGCAAATTGGGAGCAGG + Intergenic
1067099012 10:43321318-43321340 GCAGAAGGCAGAGCGGGAGCAGG - Intergenic
1067163471 10:43846463-43846485 GCTAAGGGCAGAGGAGGAGCGGG + Intergenic
1069752091 10:70751456-70751478 CCTGAGGGGAGATGGGGAGCTGG - Exonic
1069932131 10:71890021-71890043 GCAGAGGGCAGAGGGGAAGCTGG - Intergenic
1070516537 10:77213614-77213636 GGAGAGGGCAGACTGAGAGCTGG - Intronic
1070647924 10:78214333-78214355 GCAGTGGGCAGACCTGGAGGTGG - Intergenic
1070967036 10:80536132-80536154 GCGGATGGCAGCCCGGGAGCGGG - Intergenic
1071491911 10:86141953-86141975 GCTGAGGCCGGAGCTGGAGCTGG - Intronic
1074447536 10:113532956-113532978 GCTGAAGGAGGACAGGGAGCAGG - Intergenic
1075344279 10:121670761-121670783 GCTGTGGGCTGACCTAGAGCTGG - Intergenic
1075816968 10:125271863-125271885 GCTGAGTGCAGAGCTTGAGCTGG - Intergenic
1076504573 10:130963275-130963297 GCTCTGGGCAGACGGGCAGCTGG + Intergenic
1076782118 10:132730204-132730226 GCTGAGGGAAGACCAGGAGGTGG - Intronic
1076840953 10:133044914-133044936 GGTGGGGGCAGATCAGGAGCTGG - Intergenic
1077107924 11:849912-849934 GCGGGGGCCAGAGCGGGAGCAGG + Intronic
1077219892 11:1411199-1411221 GCTGAGGGGAGAGCGGGTTCTGG + Exonic
1077247610 11:1547119-1547141 GCGGAGGGCAGTCTGGGAGTGGG + Intergenic
1077293723 11:1814149-1814171 TCTGAGGGCACACAGGGAGAAGG - Intergenic
1077662864 11:4084867-4084889 GCTGAGGGGATAGAGGGAGCAGG - Intronic
1078094121 11:8286012-8286034 CCTAAGGGCAGAGCAGGAGCAGG + Intergenic
1079604100 11:22343656-22343678 GCTGAGGGCAGACCGGGAGCAGG + Intronic
1080458601 11:32435530-32435552 GCTGAGGGCAGCCAGGCAGCTGG - Exonic
1080727952 11:34916387-34916409 GCTGAGGGCAGCCCGGGGGCGGG + Exonic
1081908107 11:46681977-46681999 GTGGAGGGCAGCCCGGAAGCTGG + Intronic
1083177107 11:60957294-60957316 GCTGAAGGCAGGGTGGGAGCAGG - Intergenic
1083429349 11:62605875-62605897 GCTGAGGGGAGACCTGGCCCAGG - Exonic
1083597857 11:63927773-63927795 GCTGGGGGCAGTTAGGGAGCTGG - Intergenic
1083872492 11:65497718-65497740 GCGGAGGGGAGAGCGGGGGCGGG - Intergenic
1084160906 11:67349618-67349640 ATTGAGGGCAGACAGGCAGCGGG - Intronic
1084238953 11:67805795-67805817 GCTAAGGGCAGACCCGGAGAAGG + Intergenic
1084963583 11:72731469-72731491 GCAGAAGGCAAAGCGGGAGCAGG - Intronic
1085270796 11:75268798-75268820 GCTGAGGGCGAACCCGGGGCGGG + Intronic
1085293168 11:75414690-75414712 GCTGCTGACAGACTGGGAGCTGG + Intronic
1086601889 11:88643190-88643212 GCAGAAGGCAGAGCGAGAGCAGG + Intronic
1087077282 11:94136951-94136973 GCGGAAGGCAAACAGGGAGCAGG + Intronic
1089187997 11:116634064-116634086 GCTGAGGGCAGGCTGGGACTAGG - Intergenic
1089582810 11:119492072-119492094 GCTGATGGAAGCCTGGGAGCAGG - Intergenic
1089694513 11:120208904-120208926 GCTGAGGGCAGAGCTGGTGGCGG + Intergenic
1089729444 11:120511484-120511506 GCTGCGGGCAGGGCGGGCGCGGG - Intergenic
1090388113 11:126368383-126368405 CCTGAGGGCCGACTGCGAGCAGG - Intronic
1090424147 11:126595319-126595341 GCTGAGGGCAGTGTAGGAGCTGG + Intronic
1090478116 11:127042989-127043011 TCTGAAGGCTGACCTGGAGCTGG + Intergenic
1091322283 11:134660221-134660243 GCAGAAGGCAGAGCAGGAGCAGG - Intergenic
1091563498 12:1631233-1631255 GATAAGGGCAGACCAGGAGCCGG - Intronic
1091699932 12:2652650-2652672 GCTGGGGGCAGAGCGGGGACGGG - Intronic
1092111827 12:5969774-5969796 GGTAAGGGGAGACAGGGAGCTGG + Intronic
1093730411 12:22559835-22559857 GTGGAAGGCAGAGCGGGAGCTGG - Intergenic
1095559900 12:43552145-43552167 TCTGAGGGCAGCGCGGGCGCAGG - Intergenic
1095781683 12:46067102-46067124 GCGGAAGGCAAAACGGGAGCAGG + Intergenic
1096466479 12:51849504-51849526 GCTGATGCCACTCCGGGAGCGGG + Intergenic
1098290825 12:68955731-68955753 GCTGAGAGGAGACCCAGAGCAGG + Intronic
1100437412 12:94584322-94584344 GTGGAAGGCAGAGCGGGAGCAGG - Intronic
1100888265 12:99096488-99096510 GCTGTGGGCAGACAGGCAGGAGG + Intronic
1101786136 12:107885228-107885250 CTTGAGGGCAGACCGGGCACCGG + Intergenic
1102035436 12:109768431-109768453 GCTGCGGGCAGGCCGGGTGGTGG - Exonic
1102035614 12:109769048-109769070 GCCGGGGGCAGCCCGGGAGCTGG + Exonic
1102045682 12:109828759-109828781 GCTCATGGCAGAGCTGGAGCTGG - Intronic
1102924919 12:116819358-116819380 CCGGAGGCCAGACCCGGAGCCGG + Intronic
1104055815 12:125229053-125229075 GAGGAGGGCAGACAGGGAGCTGG + Intronic
1104337656 12:127915084-127915106 GCTGATGGCAGGCAGGGAACAGG + Intergenic
1104952424 12:132447535-132447557 GCTGAGGGCAGGCGGAGCGCTGG + Intergenic
1104978100 12:132561067-132561089 GCTGAGAGCAGAACAGGGGCCGG - Intronic
1105402640 13:20109491-20109513 GCTGAGGGCAGACTATGAGAGGG - Intergenic
1105458821 13:20565669-20565691 GCTGAAGGCAGTCTGGGGGCAGG + Intergenic
1106023402 13:25935591-25935613 GTTGAAGGCAAAGCGGGAGCTGG + Intronic
1110466322 13:75806285-75806307 TCTGAGGCCAGACCCGCAGCAGG - Intronic
1111856171 13:93640685-93640707 ACTGAGGGGAAACAGGGAGCGGG - Intronic
1112080858 13:95968621-95968643 GCAGAGGGCAGAGAGGGAGCAGG - Intronic
1112507427 13:99983217-99983239 GCTGGGCGCAGACCGCCAGCCGG + Intronic
1112647817 13:101355105-101355127 GCAGAAGGCAGACGGGGAGCAGG - Intronic
1112775371 13:102837894-102837916 CCTGAGGGCAGTCTGGGAGGCGG + Intronic
1113632256 13:111896425-111896447 GCTGAGGGCCCACTGGGAACGGG - Intergenic
1113827491 13:113268015-113268037 GGTGAGGACAGACGGGGAACTGG + Intergenic
1114073444 14:19132908-19132930 GCGGAGACCAGGCCGGGAGCAGG - Intergenic
1114088821 14:19267075-19267097 GCGGAGACCAGGCCGGGAGCAGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114610391 14:24036388-24036410 GCTGAGGGCGGGGAGGGAGCAGG + Intergenic
1115398462 14:32934447-32934469 GCTGAGGGAAGAAGGGGAGGGGG - Intergenic
1115812464 14:37124877-37124899 GCAGAGGGCAAAGCAGGAGCAGG - Intronic
1117762791 14:59049690-59049712 GCAGAAGGCAAAGCGGGAGCAGG + Intergenic
1118318440 14:64739377-64739399 GCTGAGATCAGACCTGGGGCTGG + Intronic
1118440107 14:65804447-65804469 TCTGAAGGCAAACGGGGAGCAGG + Intergenic
1118457482 14:65958020-65958042 CCTGAGGGAAGACCCTGAGCTGG - Intronic
1118643485 14:67815870-67815892 GCGGAGGGGAGAATGGGAGCTGG - Exonic
1118731515 14:68670222-68670244 GCTGAGGTCACCCTGGGAGCTGG + Intronic
1119328370 14:73775784-73775806 TCTGAGGGCAAGACGGGAGCTGG + Intronic
1119616184 14:76100619-76100641 GGTGCGGGCAGGCTGGGAGCTGG - Intergenic
1120100419 14:80438552-80438574 GCAGAAGGCAGAGGGGGAGCAGG - Intergenic
1121877814 14:97469941-97469963 GCTGAGGCCAGGGCTGGAGCAGG + Intergenic
1121970881 14:98354809-98354831 GCTGAAGGCAGACAGGCAGCAGG + Intergenic
1121975234 14:98397235-98397257 GATGAGGGCAGGGCAGGAGCCGG + Intergenic
1122267126 14:100551926-100551948 GCTGAGGGTAGACCTGGGACCGG - Intronic
1122415814 14:101549026-101549048 GCTGAGGGCAGCCTGGGGGAAGG - Intergenic
1122506696 14:102236213-102236235 GCTGAGGACTGACCGGGCCCAGG + Intronic
1122518676 14:102327070-102327092 GGTGAAGGCAGAGTGGGAGCAGG + Intronic
1123473442 15:20571055-20571077 GCCGAGGTCAGAAAGGGAGCAGG + Intergenic
1123644567 15:22429298-22429320 GCCGAGGTCAGAAAGGGAGCAGG - Intergenic
1123733739 15:23166066-23166088 GCCGAGGTCAGAAAGGGAGCAGG + Intergenic
1123751870 15:23363441-23363463 GCCGAGGTCAGAAAGGGAGCAGG + Intronic
1124284236 15:28387365-28387387 GCCGAGGTCAGAAAGGGAGCAGG + Intronic
1124298461 15:28524249-28524271 GCCGAGGTCAGAAAGGGAGCAGG - Intronic
1124600186 15:31127521-31127543 GCTGAGGGCAGCCCAGGACAGGG + Intronic
1124959922 15:34386507-34386529 GCCAAGGGCAGATAGGGAGCTGG - Intronic
1124976549 15:34532728-34532750 GCCAAGGGCAGATAGGGAGCTGG - Intronic
1125685015 15:41558949-41558971 GCTGCGGGCGGGCCGGGAGGAGG + Intronic
1125720274 15:41842007-41842029 GCAGAGGTCAGACTGGGAGGAGG - Intronic
1125775416 15:42208230-42208252 GCTAAGGGTAGACCGGGATCCGG + Exonic
1129515071 15:76152316-76152338 GCTGAGGGCAGAGTGTGGGCAGG + Intronic
1130199113 15:81808779-81808801 GTTGAGGGCTGTCCGGGAGGTGG + Intergenic
1130276335 15:82478132-82478154 GCTCAGGTCAGAAAGGGAGCAGG - Intergenic
1130380418 15:83367491-83367513 GCTGAGAACAGAACTGGAGCAGG - Intergenic
1130468697 15:84205525-84205547 GCTCAGGTCAGAAGGGGAGCAGG - Intergenic
1130476187 15:84320076-84320098 GCTCAGGTCAGAAGGGGAGCAGG - Intergenic
1130495578 15:84468054-84468076 GCTCAGGTCAGAAGGGGAGCAGG + Intergenic
1130590990 15:85210124-85210146 GCTCAGGTCAGAAGGGGAGCAGG - Intergenic
1130727316 15:86452728-86452750 GATGAGGGCAGAAGGGCAGCAGG - Intronic
1130971169 15:88734110-88734132 GCTGATGCCAGATCTGGAGCAGG - Intergenic
1131969720 15:97879776-97879798 GCAGAAGGCAGAGCAGGAGCAGG + Intergenic
1132114593 15:99126243-99126265 GCAGAGGGCTGACCAGGAGACGG - Intronic
1132591646 16:728697-728719 CCTGAGGGCAGACCGGGCAGGGG + Intronic
1133185085 16:4090157-4090179 GCTGAGGTCAGCCCTGGAGCAGG + Intronic
1133964809 16:10522999-10523021 GCTGTGGGTAGACAGGGAACTGG + Intergenic
1134024367 16:10942625-10942647 TCTGAGGGCAGACCCGAACCAGG - Intergenic
1134056667 16:11174439-11174461 GGTGAGGCCAGACAGGGAGCAGG - Intronic
1134082541 16:11335080-11335102 GTAGAAGGCAGAGCGGGAGCAGG + Intronic
1134113600 16:11531644-11531666 GCAGAGGGCAAAGCGGGAACAGG + Intergenic
1134133126 16:11663267-11663289 GCTGAGGGCAGGCTGGGGGCAGG + Intergenic
1134880252 16:17739972-17739994 GCTGGGGTCAGGCTGGGAGCAGG + Intergenic
1135269595 16:21057667-21057689 GCTGAAGGCAGGACGGGAGGTGG + Intronic
1136684057 16:31983871-31983893 GCAGAGGGCAGCCCTGGAGGTGG - Intergenic
1136784683 16:32927423-32927445 GCAGAGGGCAGCCCTGGAGGTGG - Intergenic
1136885100 16:33926383-33926405 GCAGAGGGCAGCCCTGGAGGTGG + Intergenic
1137769510 16:51004706-51004728 GCTGGGGACAGTCCAGGAGCAGG - Intergenic
1138315171 16:56063790-56063812 GCTGATGGGATACAGGGAGCTGG - Intergenic
1138531929 16:57639256-57639278 GCCCAGGCCAGACAGGGAGCTGG - Intronic
1138591184 16:58000533-58000555 GCTGCGGCCGGACCGGGGGCGGG + Intronic
1139787342 16:69404521-69404543 GCTGTGGGCAGAGGGAGAGCTGG + Intronic
1139917540 16:70437954-70437976 GCTGGGGGCAGGCAGGGACCTGG - Intronic
1139946933 16:70648022-70648044 GGTGAGGCCAGGCTGGGAGCTGG + Intronic
1141370024 16:83478378-83478400 TCTGTGGTCAGACTGGGAGCTGG - Intronic
1141381941 16:83584851-83584873 GCAGAGGGCAAAGCGGGAGTGGG + Intronic
1141831047 16:86510205-86510227 GCCGAGGGCAGCCCGGGCGAAGG - Intergenic
1142143600 16:88483361-88483383 GCTGAGGGCAGGCAGGGTCCTGG - Intronic
1142175258 16:88642332-88642354 GATGAGGGCAGAGCGGGAGGCGG + Intergenic
1203087341 16_KI270728v1_random:1191429-1191451 GCAGAGGGCAGCCCTGGAGGTGG - Intergenic
1142610962 17:1109083-1109105 GCGGAGGGCAGACAGGAAGCGGG + Intronic
1143447686 17:7018752-7018774 GCTGAGGGAAGGCCTGGAGTTGG - Intergenic
1143483477 17:7239707-7239729 GCGGCGGGGAGACCAGGAGCCGG + Intronic
1144890110 17:18489600-18489622 GCTGAGGGCAGGCTGGCAGAGGG - Intronic
1145142106 17:20454717-20454739 GCTGAGGGCAGGCTGGCAGAGGG + Intronic
1146421514 17:32690711-32690733 GCAGAAGGCAGAGGGGGAGCAGG - Intronic
1146655963 17:34635323-34635345 CCTGAGAGCAGAGGGGGAGCAGG + Intronic
1146943977 17:36861857-36861879 GCTGCAGGCAGACTGGGAGCTGG + Intergenic
1147144985 17:38479574-38479596 GCAGAGGGCAGCCCTGGAGGTGG - Intronic
1147559052 17:41497805-41497827 TCAGAGGGCAGGCCGAGAGCAGG - Intergenic
1147695292 17:42347810-42347832 GCGGAAGGCAGAGAGGGAGCAGG - Intronic
1148051464 17:44771993-44772015 GCTGGGGGCACAGGGGGAGCTGG - Intronic
1148683208 17:49486385-49486407 GCTGGGGCCAGACCGGAAACGGG + Intergenic
1148861935 17:50609144-50609166 GCTGAGGGCAGAGGGGAGGCAGG - Intronic
1148866978 17:50633881-50633903 TCTGAGGGGATACCGGGAGAAGG + Intergenic
1148867198 17:50634869-50634891 GCGGCGGGCAGAGCGGGCGCCGG - Exonic
1148895657 17:50837661-50837683 GCAGAGGGCTGACCTGGAGAGGG + Intronic
1149684278 17:58526621-58526643 GCTGCAGGAAGACCGGGGGCAGG - Intronic
1150251336 17:63706406-63706428 GGGGAGGGGAGCCCGGGAGCAGG - Intronic
1150412097 17:64953952-64953974 GCCGAAGGCAGACCTGCAGCAGG + Intergenic
1150414463 17:64975811-64975833 GGCGAGGGCAGACGGGGAACTGG - Intergenic
1150795746 17:68235432-68235454 GCTGAGGGCCACCCAGGAGCTGG + Intergenic
1150822839 17:68449657-68449679 GCGGAAGGCAAAGCGGGAGCAGG - Intronic
1150979619 17:70126614-70126636 GTTGAGGGCAGACCTGGAACTGG + Intronic
1151873230 17:76850726-76850748 GCTGAGCACAGCCCAGGAGCTGG + Intergenic
1152111622 17:78360228-78360250 GCCGAGGGCGGGCCGCGAGCAGG + Intergenic
1152423548 17:80206853-80206875 GCTGAGGGCAGGGCAGGAGCTGG - Intronic
1152895501 17:82908679-82908701 GCAGAGTGCAGACGGGGAGGTGG + Intronic
1153486094 18:5599688-5599710 GCGGAAGGCAAAGCGGGAGCAGG - Intronic
1156388205 18:36625692-36625714 GCTGGGAGCTGACTGGGAGCAGG - Exonic
1156524962 18:37758274-37758296 GCTGAAGGCAAAGGGGGAGCAGG + Intergenic
1157682039 18:49614930-49614952 GCTGAAGGCAAAGTGGGAGCAGG + Intergenic
1157715141 18:49879784-49879806 ACTGATGGCAGCCCAGGAGCTGG + Intronic
1158589622 18:58768572-58768594 GCTCGGGGCCGGCCGGGAGCTGG + Intergenic
1160563156 18:79771566-79771588 ACTGAGGGCAGCCTGAGAGCCGG - Intergenic
1160899516 19:1420540-1420562 CCTAAGGGCAGCCCGGGAGCTGG + Intronic
1160963247 19:1734106-1734128 GCTGATGCCAGGCCTGGAGCTGG - Intergenic
1161297448 19:3527032-3527054 GCTGACGGGAGACAGGGAGTAGG - Exonic
1161297463 19:3527091-3527113 GCTGACGGGAGACAGGGAGTAGG - Intronic
1161428523 19:4217518-4217540 GCTGCGGGCGGCCCTGGAGCAGG + Exonic
1161727042 19:5935612-5935634 GCTGAGGGGAGCCTGGGGGCTGG + Intronic
1161763698 19:6193927-6193949 GCGGAGGGCAAAAGGGGAGCAGG + Intronic
1162126016 19:8499886-8499908 GCTGAGGGCTGACCGGGCCTGGG - Intronic
1162499078 19:11041182-11041204 GCTGAAGGGAGAGCGGGTGCGGG + Intronic
1162925641 19:13929617-13929639 GCAGAGGGCACAGCTGGAGCAGG + Exonic
1163027078 19:14518581-14518603 GCCGAGGGCGGAGCGGGAGGGGG - Intronic
1163175501 19:15561781-15561803 GCTGTGGGCGGACAGGGGGCAGG - Intergenic
1163643350 19:18474245-18474267 GCTCAGGGCACACATGGAGCAGG - Intronic
1163653710 19:18533284-18533306 CCTGAGGGCAGCCCTGAAGCTGG - Exonic
1164686568 19:30169953-30169975 GGTGTGGGCAGATCGGGACCAGG - Intergenic
1165481643 19:36068014-36068036 GCTGATGGCAGAGAGGGAGGTGG - Intronic
1165706231 19:37978121-37978143 GTTGAGGGCAGACCCAGAGTTGG + Intronic
1165732884 19:38157715-38157737 GCTGAGGGCAGAGCTGGGGCAGG + Intronic
1166003005 19:39889457-39889479 GGTGAGAGCAGATGGGGAGCAGG - Exonic
1166005792 19:39905709-39905731 GGTGAGAGCAGATGGGGAGCAGG - Exonic
1166702667 19:44891281-44891303 GCGGAGCCCAGGCCGGGAGCAGG + Exonic
1166930893 19:46300826-46300848 CCAGAGGGCAGGCTGGGAGCTGG + Intronic
1167198000 19:48043975-48043997 GCTGAGCTCCGACAGGGAGCAGG - Exonic
1167659610 19:50788903-50788925 GCTTAAGCCAGACCAGGAGCTGG - Intergenic
1167716721 19:51146887-51146909 GGGGAGGGCGGACTGGGAGCAGG + Intronic
1168105025 19:54161222-54161244 GGTGCGGGCAGCCGGGGAGCAGG + Exonic
1168152806 19:54458038-54458060 GCTGAGGGCAGAACGGCAGCAGG - Intronic
1168324201 19:55529906-55529928 GCTGAGGGCGGTCCCGGGGCTGG + Exonic
1168332611 19:55579003-55579025 GCTGAGGGCCGAGCTGGCGCTGG - Exonic
925080568 2:1060838-1060860 GGTGAAGTCAGACCAGGAGCAGG + Intronic
925262830 2:2542985-2543007 GATGAGAGCGGACTGGGAGCGGG + Intergenic
926651898 2:15355741-15355763 GCAGAAGGCAGAGTGGGAGCAGG - Intronic
926761450 2:16282246-16282268 GCTGAGATCACACCAGGAGCCGG + Intergenic
927373247 2:22382526-22382548 GCTATGGGCAGAGCGGGATCAGG + Intergenic
927997284 2:27495013-27495035 GCTGCGGGCGGAGCGGGCGCGGG + Exonic
928105949 2:28470794-28470816 CCTGAGGACAGACCAGGAGCAGG + Intronic
928169948 2:28997349-28997371 GCTGAGAGCATACAGGGAGCAGG - Intronic
928231220 2:29500368-29500390 GCTGAAGACAGAGGGGGAGCAGG - Intronic
928549495 2:32357227-32357249 GCTGAGCGCAGGCCGGAAGATGG + Exonic
929936329 2:46297050-46297072 GCCGAGGGGCGGCCGGGAGCCGG - Intronic
931515654 2:63049519-63049541 GCCGAGAGCGGACCGGGCGCTGG - Intergenic
931784723 2:65608700-65608722 GCTGGGGGAAGTCTGGGAGCTGG + Intergenic
934048210 2:88189211-88189233 TCACAGGGCTGACCGGGAGCTGG - Intergenic
934620323 2:95799566-95799588 GCTGAGAGCAGGCCAGGAGCTGG - Intergenic
934640568 2:96024997-96025019 GCTGAGAGCAGGCCAGGAGCTGG + Intronic
935625366 2:105168242-105168264 GCTGAGGGCCGTCCTGGAGGAGG - Intergenic
936585805 2:113756657-113756679 GCGGAGGGCAAGCCGGGGGCGGG - Exonic
937233993 2:120419392-120419414 GCTGAGGGCAACCCCTGAGCTGG - Intergenic
938092036 2:128440569-128440591 GCTGAGGTCAGAAGGGGAGAGGG + Intergenic
938487381 2:131724297-131724319 GCGGAGCCCAGGCCGGGAGCAGG - Intronic
939249168 2:139663619-139663641 GTTGAAGGCAAAACGGGAGCAGG + Intergenic
941747250 2:169099842-169099864 GCTGAGAGCAGAGCCAGAGCTGG - Intergenic
946526210 2:220523524-220523546 GCAGAAGGCAAACAGGGAGCAGG - Intergenic
947637760 2:231688717-231688739 CCCGAGGGCAGGCAGGGAGCTGG + Intergenic
947864942 2:233390008-233390030 GCTGAGGGAAGGCCGGGGTCTGG - Intronic
948176248 2:235945852-235945874 GCAGAAGGCAGAGGGGGAGCCGG + Intronic
948428423 2:237902638-237902660 GTGCAGGGCAGACAGGGAGCGGG - Intronic
948560380 2:238847858-238847880 GCGGAGGGCATCCCGGGGGCCGG - Intergenic
948720132 2:239894189-239894211 GCTGAGGACAGGCAGGGAGAAGG - Intronic
948842528 2:240661197-240661219 GCAGAAGGCAAAGCGGGAGCAGG + Intergenic
948850019 2:240701287-240701309 GCTGCGGCCAGACCCGGACCAGG - Intergenic
948982151 2:241499828-241499850 GCTGAGAGCAGACGGGAGGCTGG - Intronic
1168806713 20:675945-675967 GGTGGGGGCAGGCCCGGAGCAGG + Exonic
1169266938 20:4172588-4172610 GATGAGGCCACGCCGGGAGCAGG - Intronic
1170698675 20:18683856-18683878 GCTGCAGGCAGAAAGGGAGCAGG - Intronic
1171148001 20:22802656-22802678 GCTGGGCACAGACAGGGAGCAGG + Intergenic
1172009503 20:31838150-31838172 GCTGAGGGCACACAAGGAGCAGG + Intergenic
1172447437 20:35000593-35000615 GCTGCGGGCTGCCCTGGAGCAGG + Exonic
1172450642 20:35020344-35020366 GCTGAGGGCTCACAGGGACCAGG - Intronic
1172460729 20:35116411-35116433 GGTGAGGGCAGGAAGGGAGCAGG - Intronic
1172482269 20:35277987-35278009 GGTGAGGGCAGAGCCGGGGCGGG - Intergenic
1173502076 20:43561287-43561309 GCTGAGGGCAGTCAGGAAGGAGG + Intronic
1175624733 20:60481097-60481119 GCTCAAGTCAGACTGGGAGCTGG - Intergenic
1175885642 20:62288839-62288861 GCTGAGGGCAGGAAAGGAGCAGG + Intronic
1176095980 20:63344837-63344859 GCTGATGGCAGAGCGGGGGCAGG + Exonic
1176107982 20:63398591-63398613 GCAGAGGGCAGGCAAGGAGCGGG + Intergenic
1176122051 20:63458384-63458406 GCCGAGGGCAGGAGGGGAGCAGG - Intronic
1176158723 20:63637501-63637523 GCTGATCGCAGGCCGGGTGCTGG - Intergenic
1176199393 20:63853748-63853770 CCTGAGTGGAGACGGGGAGCAGG - Intergenic
1177681372 21:24375690-24375712 GCTGTGGGCAGCACGGCAGCCGG - Intergenic
1177789714 21:25709756-25709778 GCTGAAGGCAAAGCGGGAGCAGG + Intronic
1178278202 21:31258013-31258035 GGTGAGGGCAGACCTGGATAGGG - Intronic
1178525357 21:33324392-33324414 GCTGTGTGCAGAGCGAGAGCGGG - Intergenic
1178878393 21:36429865-36429887 GCCGAGGGCACACCTAGAGCTGG - Intergenic
1180009903 21:45042786-45042808 GCTGAGGGCAATGCGGAAGCAGG - Intergenic
1180033504 21:45229014-45229036 CCTGAGGGCATAGCGGGAGGTGG - Intergenic
1180092856 21:45541884-45541906 GCGGAGGGCAGGCTGGGGGCCGG + Intronic
1180491887 22:15855261-15855283 GCGGAGACCAGGCCGGGAGCAGG - Intergenic
1180649802 22:17369031-17369053 GCCGAGGGCAGAGCCGGAGCAGG - Intronic
1180858720 22:19064543-19064565 GCTGAGCGCAGGCAGGGGGCTGG - Intronic
1181265773 22:21629761-21629783 CCTGAGGGCGGAGCGCGAGCTGG + Exonic
1181438784 22:22925147-22925169 GCTGAGGGCAGCCAGGCACCTGG - Intergenic
1181542446 22:23580527-23580549 GCTGAGGTCACACAGGGAGGTGG + Intergenic
1181919671 22:26310873-26310895 GCTGGGGGTAGCCTGGGAGCAGG + Intronic
1182109876 22:27715529-27715551 GCTGCAGGCAGACAGGAAGCAGG + Intergenic
1182236862 22:28883338-28883360 GCGGAGCGCAGACCGCGGGCGGG + Intergenic
1182494187 22:30694847-30694869 GCGGGGGGCAGGCCGGGGGCGGG - Exonic
1182769994 22:32787899-32787921 GGTCAGGGCAGTCCTGGAGCTGG + Intronic
1182859673 22:33548273-33548295 GCAGAAGGCAGAGCGGGGGCAGG - Intronic
1183697742 22:39432746-39432768 GCTTAGGGCAGAGCAGGTGCTGG - Intronic
1183977300 22:41519984-41520006 GCTGGAGGGAGCCCGGGAGCGGG + Intronic
1184113582 22:42409363-42409385 GCAGAGGGCAGGCGGGCAGCCGG + Intronic
1184549323 22:45196140-45196162 GCCGAGGGCAGGCCTGGGGCTGG + Exonic
1184571706 22:45328923-45328945 GCAGAAGGCAGAGTGGGAGCAGG + Intronic
949841108 3:8321000-8321022 ACTGAGGGCAGATCAGGAGTTGG - Intergenic
951630932 3:24719503-24719525 GCAGAAGGCAGAGTGGGAGCAGG + Intergenic
952420200 3:33123487-33123509 GCAGAAGGCAAACAGGGAGCCGG - Intronic
952881121 3:37986914-37986936 TCTGAGGGCAGACAGGGATGGGG - Intergenic
953525767 3:43688980-43689002 GCAGAGGGCAAAGCGGGAGCAGG + Intronic
953770572 3:45776127-45776149 CCTGAAGGCAGACTGGGAGTTGG + Intronic
954329812 3:49883863-49883885 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
954352883 3:50060040-50060062 GCTGAGGCGAGATGGGGAGCGGG + Intronic
954636379 3:52073110-52073132 GCTGAGGGCAGAGCTGGGGGTGG - Intergenic
954854649 3:53633574-53633596 GCTTAGGGCAAACTGGTAGCCGG + Intronic
957747865 3:84368027-84368049 GCTGAAGGCAAAGCAGGAGCAGG + Intergenic
959525194 3:107368649-107368671 GCTGAGGGCAAAGGGGAAGCGGG + Intergenic
960054654 3:113268474-113268496 GCTGAGGCCAGAAGGGAAGCTGG + Intronic
962827078 3:139107967-139107989 GCCGAGGGCAGGCAGGGGGCTGG + Intronic
964194961 3:154053011-154053033 GCTGAAGGCAAAGTGGGAGCAGG + Intergenic
964591613 3:158368480-158368502 CCTGCGGGCTGACAGGGAGCAGG + Intronic
964757178 3:160098679-160098701 GCTTAGGGGAGACCAGGAGAGGG + Intergenic
966713361 3:182991466-182991488 GCAGAAGGCAAACTGGGAGCAGG + Intergenic
966895429 3:184441319-184441341 GCTGAGGGCAGAGAGGCTGCAGG + Intronic
967874754 3:194260243-194260265 GCAGAAGGCAGAGCTGGAGCAGG - Intergenic
968067959 3:195769258-195769280 GCTGTGGGCAGACCAGGAACAGG - Intronic
968292264 3:197547840-197547862 GATGAGGGCAGAGCAGGAGCCGG - Intronic
968361043 3:198147136-198147158 GCTGCGGCCAGACAGCGAGCAGG - Intergenic
968495211 4:911418-911440 GCTGCGGGCAGCCAGAGAGCCGG - Intronic
968665930 4:1822394-1822416 GCAGAGGCCACACTGGGAGCAGG + Intronic
968916614 4:3499576-3499598 GGGGAGGGCAGAGCAGGAGCAGG - Intronic
969070758 4:4536662-4536684 GGTGAGGCCAGAGAGGGAGCAGG + Intronic
969312976 4:6364837-6364859 GCTGGGGGCAGACAGGCAGGTGG + Intronic
969619536 4:8272145-8272167 GCTCAGGGCTGGCAGGGAGCTGG + Intronic
969669370 4:8581279-8581301 GCTGAGCGCAGACCAGTGGCTGG + Exonic
969859885 4:10027447-10027469 GCTGAGGGGAGAATGGAAGCTGG - Intronic
970571182 4:17384462-17384484 GCAGAAGGCAGAAAGGGAGCAGG - Intergenic
970801716 4:19979747-19979769 GCAGAAGGCAGAGGGGGAGCAGG - Intergenic
973642600 4:52918019-52918041 GCATAGGTCAGACCGGGAACAGG + Intronic
974163223 4:58166932-58166954 GCTTAGGGGAGACAGGGAGGTGG - Intergenic
975434340 4:74334226-74334248 GCTGAGTGCAGAGCTGCAGCGGG - Intergenic
979831896 4:125315007-125315029 GGGGAGGGAAGACCGCGAGCTGG - Intergenic
982711082 4:158759417-158759439 GAGGAGGGCAGATCAGGAGCTGG - Intergenic
984306285 4:177996128-177996150 CCTGAGGGCAGAACAGTAGCCGG - Intergenic
985309066 4:188577528-188577550 ACAGAGGGCAGAGGGGGAGCAGG + Intergenic
985659857 5:1151686-1151708 GCTCAGTGCAGCCCGGGAGGCGG + Intergenic
985733034 5:1561530-1561552 GCGGAGGACAGACCTGGACCTGG + Intergenic
985879045 5:2624204-2624226 GCTCAGGGCTGACCGGGAAAAGG + Intergenic
986528203 5:8703765-8703787 GCTGAGGGCAGACCAGATGCGGG - Intergenic
987049171 5:14135280-14135302 GCTGAGGGCAAGCCGGGAAGGGG - Intergenic
990889986 5:60637387-60637409 GCAGAAGGCAAAACGGGAGCAGG - Intronic
991491946 5:67192545-67192567 GCAGAAGGCAGACGGGGAGCAGG + Intronic
992721055 5:79561649-79561671 GCAGAAGGCAAAGCGGGAGCAGG + Intergenic
993901350 5:93585678-93585700 GATGAGCGCAGGCCGGGAGGGGG - Intronic
994021122 5:95027341-95027363 ACTAAGGGCAGACAGTGAGCAGG + Intronic
995106202 5:108380908-108380930 GCGGAGGGCAGAGCGGCTGCGGG + Exonic
995119776 5:108523289-108523311 AGTGGGGGCAGACAGGGAGCTGG + Intergenic
996165285 5:120215104-120215126 GCTGATGGCAGCCTGGGATCAGG + Intergenic
996517901 5:124394010-124394032 ACTGAGGGCAGTCCAGGTGCTGG - Intergenic
996796542 5:127354115-127354137 GCTGTGGGCAGATAAGGAGCTGG + Intronic
999421382 5:151447679-151447701 GCTGAAGCCAGAGCCGGAGCCGG + Exonic
999640003 5:153662950-153662972 GGTGAGAGCAGAGCGGGAGAGGG - Intronic
999971581 5:156869134-156869156 GCAGAGGGCAAAGCGGGAGCAGG - Intergenic
1000418167 5:161005934-161005956 GCAGAAGGCAAACTGGGAGCAGG - Intergenic
1000897637 5:166874790-166874812 GCTGAGGGGAGAGCAGCAGCAGG - Intergenic
1001316109 5:170642221-170642243 GCTGGGGACATGCCGGGAGCTGG + Intronic
1001969973 5:175947652-175947674 GCTGAGGGAACAACAGGAGCAGG - Intronic
1002247464 5:177896112-177896134 GCTGAGGGAACAACAGGAGCAGG + Intergenic
1002455705 5:179344678-179344700 GCAGCGGGCTGAGCGGGAGCTGG - Intronic
1002562234 5:180090381-180090403 GCTGAGGCCAGACCTGGGGGAGG + Intergenic
1002636546 5:180611618-180611640 GCTGAGGGCAGGGCGAGGGCGGG - Intronic
1003052641 6:2793601-2793623 GCTGAGGGCCGACAGTGAGCAGG + Intergenic
1003652992 6:7978400-7978422 GCAGAAGGCAAAGCGGGAGCAGG - Intronic
1003660891 6:8060566-8060588 GGTGAGGGCTGACGGTGAGCTGG + Intronic
1004570276 6:16838247-16838269 GCTGAGGCCAGGCTGAGAGCAGG - Intergenic
1004658075 6:17684072-17684094 GCAGAAGGCAGAGTGGGAGCAGG - Intronic
1004700706 6:18076935-18076957 GCAGAGGGCAAAAGGGGAGCTGG + Intergenic
1006020059 6:31112495-31112517 GATGAAGACAGACCAGGAGCAGG + Exonic
1006097307 6:31664133-31664155 ACTGAGGGCAGCCCAGGAGGGGG - Exonic
1006903416 6:37517243-37517265 ACTGAGGGCAGTCGGGGAGGAGG + Intergenic
1006910367 6:37559452-37559474 GCTGCAGGCAGAGCTGGAGCTGG + Intergenic
1007530732 6:42539864-42539886 GCTGTGGGGAGACAGGGAGTTGG - Intergenic
1008759000 6:54831667-54831689 GCTGAGGGCACAGTGGAAGCCGG - Intergenic
1011542481 6:88447036-88447058 GCTGAGAGCAGAACAGGAGGTGG + Intergenic
1011624404 6:89271560-89271582 TGTGTGGGCAGAGCGGGAGCTGG - Intronic
1012716047 6:102671928-102671950 GCTGAGGGCAGGGCAGGAGTAGG + Intergenic
1013370814 6:109469761-109469783 TCTGAGTGCAGACAGGGTGCTGG + Intronic
1013507530 6:110815091-110815113 GCTGGCGGCGGAGCGGGAGCGGG - Exonic
1013820347 6:114146817-114146839 GCAGAGGGTAAAGCGGGAGCAGG - Intronic
1014839187 6:126197825-126197847 GCTGAGGGCAGCTGGGGATCAGG - Intergenic
1015961825 6:138658128-138658150 GCTGAGGGCAGAGGAGGAGGTGG - Intronic
1016934674 6:149440935-149440957 GCTGAAGGCACAGGGGGAGCTGG - Intergenic
1017507106 6:155078717-155078739 AATGAGAGCAGACTGGGAGCAGG - Intronic
1018118065 6:160607374-160607396 GCAGAGGGTAGACTGAGAGCAGG - Intronic
1018118682 6:160613822-160613844 GCAGAGGGTAGACTGAGAGCAGG - Intronic
1018119283 6:160619374-160619396 GCAGAGGGTAGACTGAGAGCAGG - Intronic
1018119886 6:160624920-160624942 GCAGAGGGTAGACTGAGAGCAGG - Intronic
1018120487 6:160630464-160630486 GCAGAGGGTAGACTGAGAGCAGG - Intronic
1018121083 6:160636013-160636035 GCAGAGGGTAGACTGAGAGCAGG - Intronic
1018121685 6:160641556-160641578 GCAGAGGGTAGACTGAGAGCAGG - Intronic
1018433465 6:163741792-163741814 GCTGAGGGCAGAAAGAGACCTGG - Intergenic
1019107164 6:169677790-169677812 GCTGAGGCCAGAGCTGGAGACGG - Intronic
1019258967 7:69518-69540 GCTGCGGCCAGACAGCGAGCAGG + Intergenic
1019932684 7:4234310-4234332 CCTGAGAGCAGACCTGGACCTGG - Intronic
1020824648 7:13011370-13011392 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
1022090260 7:27103504-27103526 GCTGAGGGGAGAAGGGGAGGCGG - Intergenic
1022101179 7:27169962-27169984 GCCGGGGCCAGACAGGGAGCCGG - Intronic
1022540563 7:31131293-31131315 GCTGAGGGAGGACGGGGAGGTGG + Intergenic
1026149542 7:67776309-67776331 GCTGTGGGTTGACCAGGAGCAGG - Intergenic
1027711525 7:81608718-81608740 GCTAAGGGCAAATGGGGAGCTGG - Intergenic
1029177956 7:98678282-98678304 GCAGAGGGAAGAAGGGGAGCAGG + Intergenic
1029276523 7:99408464-99408486 GCTGAGGGGACAGCGGAAGCCGG + Intronic
1032083186 7:128870051-128870073 GCTGGGGGCCGCCCGGGAGGGGG - Intronic
1032517465 7:132517808-132517830 GCTGAGGGCAGTGAGGGAGTTGG + Intronic
1035087030 7:156269091-156269113 GCTGGGGGCAGATGGGGAGGAGG + Intergenic
1035332896 7:158107871-158107893 GCTGTGGGCAGACGGTGTGCAGG - Intronic
1035628343 8:1090256-1090278 CCAGAGGGCAGACAGGCAGCAGG - Intergenic
1035628360 8:1090322-1090344 CCAGAGGGCAGACATGGAGCAGG - Intergenic
1035644369 8:1206881-1206903 GCCGGGGGCAGACCGGGGACAGG - Intergenic
1035683758 8:1508252-1508274 GCAGGGGGCAGCCCGGGAGCAGG - Intronic
1036999896 8:13705599-13705621 TGTGAGGACAGACTGGGAGCTGG + Intergenic
1037823998 8:22149885-22149907 TCTGAGGGAAGATCAGGAGCTGG - Intronic
1038963786 8:32549131-32549153 GCTGAGCCCAGCCCGGGAGTGGG + Intronic
1040319935 8:46287369-46287391 GATGAGGCCAGAGCAGGAGCTGG - Intergenic
1041964067 8:63654070-63654092 GCAGAAGGCAGAGCGGGAGCAGG + Intergenic
1042033705 8:64506898-64506920 GCAGAGGGCAAAGTGGGAGCAGG - Intergenic
1043848943 8:85193619-85193641 GTTGAGGGCTGACTGGGAGGAGG - Intronic
1044584737 8:93859083-93859105 GCAGAGGTGAGACCTGGAGCTGG - Intronic
1046314070 8:112477648-112477670 GCAGAAGGCAAAGCGGGAGCAGG - Intronic
1048990686 8:139758512-139758534 GCTGTGGGGAGGCCGGGGGCAGG + Intronic
1049060489 8:140272693-140272715 GAAGAGGGCAAAGCGGGAGCAGG + Intronic
1049062342 8:140286129-140286151 ACTGAGGGAAGCCCAGGAGCCGG + Intronic
1049255723 8:141612577-141612599 GCTGAGAGCTGGCCAGGAGCAGG - Intergenic
1049388025 8:142354047-142354069 GCTGACAGCAGAGCAGGAGCGGG + Intronic
1049401873 8:142431566-142431588 GTTGAGGACAGAAGGGGAGCAGG + Intergenic
1049690722 8:143957755-143957777 GCTGAGGGCAGGCAGGGTGGTGG - Intronic
1049707015 8:144047691-144047713 ACTGAGGGCAGATGGGGTGCTGG + Intergenic
1049832814 8:144713166-144713188 TCTCAGAGCAGACCGAGAGCAGG + Intergenic
1050074695 9:1851558-1851580 GCTGATGGCAAAGGGGGAGCAGG - Intergenic
1050111666 9:2223131-2223153 GCGGAAGGCAAACGGGGAGCAGG + Intergenic
1050589773 9:7149311-7149333 GCAGAGTGCATACCAGGAGCGGG + Intergenic
1052908251 9:33856219-33856241 GCTGAGGACTGACCGGGAGTAGG - Intronic
1056814546 9:89791938-89791960 GCTGAGAGCAGGCTGGGAGCAGG + Intergenic
1057833015 9:98420888-98420910 TCTGAAGGCAGGCAGGGAGCAGG + Intronic
1059411807 9:114137246-114137268 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
1060219673 9:121757729-121757751 GCTGAGACCAAGCCGGGAGCAGG + Intronic
1060532286 9:124354971-124354993 GCTGCGGGCAGACAGGCAGCAGG + Intronic
1060817099 9:126640737-126640759 ACTGAGGGCAGACAGGATGCTGG + Intronic
1061802827 9:133121374-133121396 GCCGAGGTCAGACCCGGGGCGGG + Intronic
1061870762 9:133519122-133519144 GCTGAGGGGACACCGAGAGAGGG - Intronic
1061939289 9:133875411-133875433 GCAGAGGGCAGGCCCTGAGCAGG + Intronic
1062174106 9:135151462-135151484 GCTGAGGGCAGGACGGCATCAGG - Intergenic
1062266839 9:135690448-135690470 GCTGAGGGCAGGCAGGGGGAGGG + Intergenic
1062390121 9:136330515-136330537 GCTGGGAGCACAGCGGGAGCTGG - Intronic
1062745750 9:138210963-138210985 GCTGCGGCCAGACAGGGAGCAGG - Intergenic
1185891764 X:3828307-3828329 GGTGAAGGCAGAGTGGGAGCAGG - Intronic
1185896872 X:3866723-3866745 GGTGAAGGCAGAGTGGGAGCAGG - Intergenic
1185901990 X:3905149-3905171 GGTGAAGGCAGAGTGGGAGCAGG - Intergenic
1187868263 X:23743249-23743271 GCTGAGGACAGCCCGGGAGCCGG + Exonic
1188005952 X:25015896-25015918 GCCGCGGGCAGGGCGGGAGCCGG - Exonic
1188618743 X:32193122-32193144 GCAGAAGGCAGAACGGGAGCAGG - Intronic
1189278191 X:39802690-39802712 GCTGAAGACAGCCCTGGAGCCGG - Intergenic
1190054987 X:47176121-47176143 GGTGAGGGGAGACAGGGAGGGGG - Intronic
1190090154 X:47430332-47430354 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
1195617248 X:106922119-106922141 GGTGAGGGCAGACAGGGTCCTGG - Intronic
1195672557 X:107482183-107482205 GCTGTGGGAAGACCGGGGGGAGG - Intergenic
1196768902 X:119273639-119273661 TCTGAGGGCAGCCCGCGCGCGGG - Intergenic
1197094148 X:122573853-122573875 GCAGAAGGCAGAATGGGAGCAGG + Intergenic
1200081089 X:153576714-153576736 GCTGAGAGCAGAGCAGGAGGCGG + Intronic
1200148575 X:153940233-153940255 GCTGAGGGGAGAGCAGGGGCAGG + Exonic