ID: 1079607384 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:22387062-22387084 |
| Sequence | AATTGAAGGGATTTTAGGTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1079607378_1079607384 | 7 | Left | 1079607378 | 11:22387032-22387054 | CCAGACTAAATTGTTCAAATTTT | No data | ||
| Right | 1079607384 | 11:22387062-22387084 | AATTGAAGGGATTTTAGGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1079607384 | Original CRISPR | AATTGAAGGGATTTTAGGTG GGG | Intergenic | ||