ID: 1079607384

View in Genome Browser
Species Human (GRCh38)
Location 11:22387062-22387084
Sequence AATTGAAGGGATTTTAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079607378_1079607384 7 Left 1079607378 11:22387032-22387054 CCAGACTAAATTGTTCAAATTTT No data
Right 1079607384 11:22387062-22387084 AATTGAAGGGATTTTAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079607384 Original CRISPR AATTGAAGGGATTTTAGGTG GGG Intergenic