ID: 1079608671

View in Genome Browser
Species Human (GRCh38)
Location 11:22403087-22403109
Sequence GATAGAGGGCTCACTAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079608667_1079608671 9 Left 1079608667 11:22403055-22403077 CCAAGTTTCTGGCATAAGAAAAT No data
Right 1079608671 11:22403087-22403109 GATAGAGGGCTCACTAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079608671 Original CRISPR GATAGAGGGCTCACTAACTG AGG Intergenic