ID: 1079614782

View in Genome Browser
Species Human (GRCh38)
Location 11:22478805-22478827
Sequence CCCCAAATACTGCAAATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079614782_1079614786 27 Left 1079614782 11:22478805-22478827 CCTTATATTTGCAGTATTTGGGG No data
Right 1079614786 11:22478855-22478877 TCCACACAATTCTTTTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079614782 Original CRISPR CCCCAAATACTGCAAATATA AGG (reversed) Intergenic
No off target data available for this crispr