ID: 1079614811

View in Genome Browser
Species Human (GRCh38)
Location 11:22479206-22479228
Sequence CACTCAGTATGGAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079614806_1079614811 7 Left 1079614806 11:22479176-22479198 CCCGCATATGTGTGCTAAAGTAA No data
Right 1079614811 11:22479206-22479228 CACTCAGTATGGAGGGTAGAAGG No data
1079614807_1079614811 6 Left 1079614807 11:22479177-22479199 CCGCATATGTGTGCTAAAGTAAT No data
Right 1079614811 11:22479206-22479228 CACTCAGTATGGAGGGTAGAAGG No data
1079614805_1079614811 8 Left 1079614805 11:22479175-22479197 CCCCGCATATGTGTGCTAAAGTA No data
Right 1079614811 11:22479206-22479228 CACTCAGTATGGAGGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079614811 Original CRISPR CACTCAGTATGGAGGGTAGA AGG Intergenic
No off target data available for this crispr