ID: 1079615630

View in Genome Browser
Species Human (GRCh38)
Location 11:22489162-22489184
Sequence CATCTAAGACTTCTCTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079615630_1079615631 -1 Left 1079615630 11:22489162-22489184 CCATTCTAGAGAAGTCTTAGATG No data
Right 1079615631 11:22489184-22489206 GAAAATGAGAAACATATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079615630 Original CRISPR CATCTAAGACTTCTCTAGAA TGG (reversed) Intergenic
No off target data available for this crispr