ID: 1079616279

View in Genome Browser
Species Human (GRCh38)
Location 11:22497508-22497530
Sequence CTGTGAGTAATGTGGCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079616279_1079616283 -8 Left 1079616279 11:22497508-22497530 CCAGTTTGCCACATTACTCACAG No data
Right 1079616283 11:22497523-22497545 ACTCACAGGCTGGCACTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079616279 Original CRISPR CTGTGAGTAATGTGGCAAAC TGG (reversed) Intergenic
No off target data available for this crispr