ID: 1079617652

View in Genome Browser
Species Human (GRCh38)
Location 11:22514768-22514790
Sequence TTGGGTGGAACAGTGATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079617652_1079617658 5 Left 1079617652 11:22514768-22514790 CCAGGAATCACTGTTCCACCCAA No data
Right 1079617658 11:22514796-22514818 TGTTTGCAGTGGAAGCAGCTGGG No data
1079617652_1079617654 -6 Left 1079617652 11:22514768-22514790 CCAGGAATCACTGTTCCACCCAA No data
Right 1079617654 11:22514785-22514807 ACCCAAACTTATGTTTGCAGTGG No data
1079617652_1079617657 4 Left 1079617652 11:22514768-22514790 CCAGGAATCACTGTTCCACCCAA No data
Right 1079617657 11:22514795-22514817 ATGTTTGCAGTGGAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079617652 Original CRISPR TTGGGTGGAACAGTGATTCC TGG (reversed) Intergenic
No off target data available for this crispr