ID: 1079622010

View in Genome Browser
Species Human (GRCh38)
Location 11:22566887-22566909
Sequence CCCCTGCTGCCCTCAGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079622010_1079622018 8 Left 1079622010 11:22566887-22566909 CCCCTGACTGAGGGCAGCAGGGG No data
Right 1079622018 11:22566918-22566940 CTGCCATGGCAGTGGCAGAAGGG No data
1079622010_1079622021 26 Left 1079622010 11:22566887-22566909 CCCCTGACTGAGGGCAGCAGGGG No data
Right 1079622021 11:22566936-22566958 AAGGGTTGTCCATTACTTCTGGG No data
1079622010_1079622016 0 Left 1079622010 11:22566887-22566909 CCCCTGACTGAGGGCAGCAGGGG No data
Right 1079622016 11:22566910-22566932 TGGAACTGCTGCCATGGCAGTGG No data
1079622010_1079622020 25 Left 1079622010 11:22566887-22566909 CCCCTGACTGAGGGCAGCAGGGG No data
Right 1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG No data
1079622010_1079622017 7 Left 1079622010 11:22566887-22566909 CCCCTGACTGAGGGCAGCAGGGG No data
Right 1079622017 11:22566917-22566939 GCTGCCATGGCAGTGGCAGAAGG No data
1079622010_1079622015 -6 Left 1079622010 11:22566887-22566909 CCCCTGACTGAGGGCAGCAGGGG No data
Right 1079622015 11:22566904-22566926 CAGGGGTGGAACTGCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079622010 Original CRISPR CCCCTGCTGCCCTCAGTCAG GGG (reversed) Intergenic