ID: 1079622012

View in Genome Browser
Species Human (GRCh38)
Location 11:22566888-22566910
Sequence ACCCCTGCTGCCCTCAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079622012_1079622018 7 Left 1079622012 11:22566888-22566910 CCCTGACTGAGGGCAGCAGGGGT No data
Right 1079622018 11:22566918-22566940 CTGCCATGGCAGTGGCAGAAGGG No data
1079622012_1079622015 -7 Left 1079622012 11:22566888-22566910 CCCTGACTGAGGGCAGCAGGGGT No data
Right 1079622015 11:22566904-22566926 CAGGGGTGGAACTGCTGCCATGG No data
1079622012_1079622020 24 Left 1079622012 11:22566888-22566910 CCCTGACTGAGGGCAGCAGGGGT No data
Right 1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG No data
1079622012_1079622017 6 Left 1079622012 11:22566888-22566910 CCCTGACTGAGGGCAGCAGGGGT No data
Right 1079622017 11:22566917-22566939 GCTGCCATGGCAGTGGCAGAAGG No data
1079622012_1079622021 25 Left 1079622012 11:22566888-22566910 CCCTGACTGAGGGCAGCAGGGGT No data
Right 1079622021 11:22566936-22566958 AAGGGTTGTCCATTACTTCTGGG No data
1079622012_1079622016 -1 Left 1079622012 11:22566888-22566910 CCCTGACTGAGGGCAGCAGGGGT No data
Right 1079622016 11:22566910-22566932 TGGAACTGCTGCCATGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079622012 Original CRISPR ACCCCTGCTGCCCTCAGTCA GGG (reversed) Intergenic