ID: 1079622013

View in Genome Browser
Species Human (GRCh38)
Location 11:22566889-22566911
Sequence CACCCCTGCTGCCCTCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079622013_1079622016 -2 Left 1079622013 11:22566889-22566911 CCTGACTGAGGGCAGCAGGGGTG No data
Right 1079622016 11:22566910-22566932 TGGAACTGCTGCCATGGCAGTGG No data
1079622013_1079622021 24 Left 1079622013 11:22566889-22566911 CCTGACTGAGGGCAGCAGGGGTG No data
Right 1079622021 11:22566936-22566958 AAGGGTTGTCCATTACTTCTGGG No data
1079622013_1079622018 6 Left 1079622013 11:22566889-22566911 CCTGACTGAGGGCAGCAGGGGTG No data
Right 1079622018 11:22566918-22566940 CTGCCATGGCAGTGGCAGAAGGG No data
1079622013_1079622017 5 Left 1079622013 11:22566889-22566911 CCTGACTGAGGGCAGCAGGGGTG No data
Right 1079622017 11:22566917-22566939 GCTGCCATGGCAGTGGCAGAAGG No data
1079622013_1079622015 -8 Left 1079622013 11:22566889-22566911 CCTGACTGAGGGCAGCAGGGGTG No data
Right 1079622015 11:22566904-22566926 CAGGGGTGGAACTGCTGCCATGG No data
1079622013_1079622020 23 Left 1079622013 11:22566889-22566911 CCTGACTGAGGGCAGCAGGGGTG No data
Right 1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079622013 Original CRISPR CACCCCTGCTGCCCTCAGTC AGG (reversed) Intergenic