ID: 1079622019

View in Genome Browser
Species Human (GRCh38)
Location 11:22566921-22566943
Sequence CAACCCTTCTGCCACTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079622019_1079622021 -8 Left 1079622019 11:22566921-22566943 CCATGGCAGTGGCAGAAGGGTTG No data
Right 1079622021 11:22566936-22566958 AAGGGTTGTCCATTACTTCTGGG No data
1079622019_1079622020 -9 Left 1079622019 11:22566921-22566943 CCATGGCAGTGGCAGAAGGGTTG No data
Right 1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG No data
1079622019_1079622027 30 Left 1079622019 11:22566921-22566943 CCATGGCAGTGGCAGAAGGGTTG No data
Right 1079622027 11:22566974-22566996 AATCACAGAGCCACTGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079622019 Original CRISPR CAACCCTTCTGCCACTGCCA TGG (reversed) Intergenic