ID: 1079622020

View in Genome Browser
Species Human (GRCh38)
Location 11:22566935-22566957
Sequence GAAGGGTTGTCCATTACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079622019_1079622020 -9 Left 1079622019 11:22566921-22566943 CCATGGCAGTGGCAGAAGGGTTG No data
Right 1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG No data
1079622010_1079622020 25 Left 1079622010 11:22566887-22566909 CCCCTGACTGAGGGCAGCAGGGG No data
Right 1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG No data
1079622012_1079622020 24 Left 1079622012 11:22566888-22566910 CCCTGACTGAGGGCAGCAGGGGT No data
Right 1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG No data
1079622013_1079622020 23 Left 1079622013 11:22566889-22566911 CCTGACTGAGGGCAGCAGGGGTG No data
Right 1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079622020 Original CRISPR GAAGGGTTGTCCATTACTTC TGG Intergenic