ID: 1079622021

View in Genome Browser
Species Human (GRCh38)
Location 11:22566936-22566958
Sequence AAGGGTTGTCCATTACTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079622012_1079622021 25 Left 1079622012 11:22566888-22566910 CCCTGACTGAGGGCAGCAGGGGT No data
Right 1079622021 11:22566936-22566958 AAGGGTTGTCCATTACTTCTGGG No data
1079622013_1079622021 24 Left 1079622013 11:22566889-22566911 CCTGACTGAGGGCAGCAGGGGTG No data
Right 1079622021 11:22566936-22566958 AAGGGTTGTCCATTACTTCTGGG No data
1079622010_1079622021 26 Left 1079622010 11:22566887-22566909 CCCCTGACTGAGGGCAGCAGGGG No data
Right 1079622021 11:22566936-22566958 AAGGGTTGTCCATTACTTCTGGG No data
1079622019_1079622021 -8 Left 1079622019 11:22566921-22566943 CCATGGCAGTGGCAGAAGGGTTG No data
Right 1079622021 11:22566936-22566958 AAGGGTTGTCCATTACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079622021 Original CRISPR AAGGGTTGTCCATTACTTCT GGG Intergenic