ID: 1079622027

View in Genome Browser
Species Human (GRCh38)
Location 11:22566974-22566996
Sequence AATCACAGAGCCACTGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079622022_1079622027 6 Left 1079622022 11:22566945-22566967 CCATTACTTCTGGGAAACCCTCC No data
Right 1079622027 11:22566974-22566996 AATCACAGAGCCACTGCCAGTGG No data
1079622019_1079622027 30 Left 1079622019 11:22566921-22566943 CCATGGCAGTGGCAGAAGGGTTG No data
Right 1079622027 11:22566974-22566996 AATCACAGAGCCACTGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079622027 Original CRISPR AATCACAGAGCCACTGCCAG TGG Intergenic