ID: 1079633173

View in Genome Browser
Species Human (GRCh38)
Location 11:22702818-22702840
Sequence CAGAGCAAGGAGAAGAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 766}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079633169_1079633173 12 Left 1079633169 11:22702783-22702805 CCCTATTCTGTACTCTGCTGAGA 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG 0: 1
1: 0
2: 2
3: 63
4: 766
1079633170_1079633173 11 Left 1079633170 11:22702784-22702806 CCTATTCTGTACTCTGCTGAGAA 0: 1
1: 0
2: 2
3: 21
4: 229
Right 1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG 0: 1
1: 0
2: 2
3: 63
4: 766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079633173 Original CRISPR CAGAGCAAGGAGAAGAGATA GGG Intronic
900829321 1:4953867-4953889 TACAGCAAAGAGAAGAGAAATGG + Intergenic
901233142 1:7652307-7652329 CAGAGCAAGCAGGAGAGGAAGGG - Intronic
902433919 1:16384733-16384755 AAAAGCAAAGAGAAGAAATAAGG - Intronic
903096772 1:20983880-20983902 CAGAGTAAGAAAAATAGATACGG + Intronic
903531476 1:24033717-24033739 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
904241441 1:29148828-29148850 AAGAGCAAGGACAAGAGGAAGGG - Exonic
905753776 1:40489565-40489587 TAGAGAAAGGAGAAGAGCCATGG + Exonic
905759404 1:40541651-40541673 TAGAGCAAGGACAAGAGCCATGG + Exonic
905760208 1:40550110-40550132 CAGATAAAGGAAGAGAGATAGGG + Intergenic
906387232 1:45380644-45380666 CAGAGCAAAGAGAAAGAATAAGG + Intronic
907381814 1:54096926-54096948 TAGAGCAAAGAGAACAGACAGGG - Exonic
907386326 1:54127934-54127956 CAGAGCAGGGTGAAGAGGAACGG - Intergenic
907576567 1:55531407-55531429 CAAAGAAAGAAGAAGAGAGAAGG - Intergenic
907934600 1:59031082-59031104 CATTGCAAGGAAAATAGATAAGG + Intergenic
908140015 1:61174466-61174488 CAGTGCAAGGGGCAGAGAGATGG + Intronic
908168304 1:61480631-61480653 CAGAGCCAGGACAAGTGACAAGG + Intergenic
908342093 1:63192024-63192046 GAGAGCATAGAGAAGAGATGAGG + Intergenic
908503268 1:64766538-64766560 AAGAGCTATGAGTAGAGATATGG + Intronic
909222804 1:72984314-72984336 CAGAGAAAAGAGTAGAGACAGGG + Intergenic
909471247 1:76030824-76030846 CTTAGCAAAGAGAAGATATAGGG + Intergenic
909503523 1:76362173-76362195 CAGAGCAGGAAGAAGAGAGGCGG + Intronic
909724643 1:78819645-78819667 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
909793124 1:79700824-79700846 CAGAGAAAAGAGTAGAGACATGG + Intergenic
909843137 1:80355701-80355723 CAGAGGAAGGAGTAGTAATAAGG + Intergenic
910851722 1:91655542-91655564 CTGAGCAACGAGAAGAGAGGAGG - Intergenic
912041109 1:105391896-105391918 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
912413551 1:109493648-109493670 AAGAGCAAGGAGAATAGGAAAGG - Intergenic
912812401 1:112804089-112804111 CAGAGCAGGTACAGGAGATAAGG - Intergenic
913404810 1:118477840-118477862 CAGAGGAAAGAGAAGATAGATGG - Intergenic
913534662 1:119759694-119759716 CAGAGGGAGGAGAGGAGAAATGG - Intronic
915648982 1:157293941-157293963 CAGAGCAAGGGCAAGAGAGATGG + Intergenic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916202453 1:162284873-162284895 CAAAGCAAGAAAGAGAGATATGG + Intronic
916945888 1:169727118-169727140 CAGAGAGAGGAGAGGAGAAAGGG - Intronic
917052178 1:170937048-170937070 CTGGGAAAGGAGGAGAGATAAGG + Intronic
917253099 1:173083928-173083950 CAGAGCAAGGAGACAATCTATGG + Intergenic
917336491 1:173928996-173929018 AAGAGCAAGGAGCAGTGAGATGG - Intergenic
917653975 1:177107470-177107492 CAGAGCAAGGAGAAAAAAAGTGG - Intronic
917685795 1:177414501-177414523 CAGAGAAAGGAGCAGAGGAAGGG + Intergenic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
918714556 1:187769978-187770000 CAGAGAAAAGAGTAGAGACACGG + Intergenic
919708672 1:200704511-200704533 CTGAGGAAGGGGAAGACATAAGG - Intergenic
919841110 1:201610045-201610067 CAGAAGAAGGAGCAGAGAGAAGG + Intergenic
920728263 1:208458080-208458102 CAGAGTAAGGAGGAAAAATAGGG - Intergenic
920822358 1:209392855-209392877 CAGAGCTAGGACTAGAAATAGGG + Intergenic
921212267 1:212910718-212910740 CAGAGAAAAGAGTAGAGACACGG - Intergenic
921693905 1:218184861-218184883 GAGAGAAAGCAGAATAGATAAGG - Intergenic
921905207 1:220488656-220488678 CACAGCAAGAGGAACAGATATGG - Intergenic
921975612 1:221199748-221199770 CAGGGCAATGAGAAAAGAAAAGG - Intergenic
922608498 1:226906602-226906624 CAGAGCAGGGAAAAGACAAAGGG - Intronic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
923078651 1:230633002-230633024 CTGTGCAGGGAGTAGAGATAGGG + Intergenic
923408770 1:233687927-233687949 CAGAGAAAAGAGTAGAGACACGG + Intergenic
923770884 1:236936732-236936754 CAGAGAAAAGAGTAGAGACACGG + Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063036921 10:2295396-2295418 CCAAGCAGGGAGAAGAGACATGG + Intergenic
1063938983 10:11107937-11107959 GAGAGCAAGGAGACGGGATGGGG - Intronic
1064462733 10:15550834-15550856 GAGAGGAAAGAGAAGAGAGAGGG + Intronic
1064663966 10:17631310-17631332 CAGAGAAAAGAGTAGAGACATGG + Intergenic
1065165805 10:22975872-22975894 CATAGAAAGGAGAACAGAGATGG - Intronic
1065377197 10:25055282-25055304 TTGAGCAGGGAGAAGAAATAAGG + Intronic
1065379023 10:25070267-25070289 CACATTTAGGAGAAGAGATAAGG - Intergenic
1065450612 10:25852593-25852615 CAGAGAGGGGTGAAGAGATAAGG + Intergenic
1067072452 10:43144414-43144436 CAAGGCAAGGAGAAAAGATATGG + Intronic
1067325491 10:45262119-45262141 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1067475285 10:46560907-46560929 CAGAGCAAGAAGAAATGATGGGG + Intergenic
1067742167 10:48903928-48903950 CAGAGCCAGCTGAAGAGATGGGG + Intronic
1067842074 10:49688906-49688928 ACGAGCAAGAAGAAGAAATAAGG - Intronic
1068179803 10:53503532-53503554 CAGAGAAAAGAGTAGAGACATGG + Intergenic
1068220297 10:54036014-54036036 CAGAGAAAGGAAGAGAGTTAAGG - Intronic
1068243120 10:54331004-54331026 AAGGGGAAGGAGAAGAGAAAGGG + Intronic
1068862079 10:61857559-61857581 CTAAGGAAAGAGAAGAGATAAGG + Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071916060 10:90296232-90296254 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1072431396 10:95374706-95374728 GAGAGAAAGGAGAAGAAATGAGG + Intronic
1072511279 10:96128506-96128528 AAGAGAAAGGGGAAGAGATAAGG + Intergenic
1072580114 10:96733440-96733462 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1073032298 10:100536256-100536278 GAGAGAAAGGCGAGGAGATACGG + Intronic
1073137793 10:101229374-101229396 CAGAGAAGAGAGAAGAGAGAGGG - Exonic
1073142200 10:101255525-101255547 CACAGGAAGGAGAAGAGGTTAGG - Intergenic
1073735959 10:106346644-106346666 GAGAGGAAGAAGAAGAGAAAAGG - Intergenic
1074011764 10:109489567-109489589 CAGAGCAAGAGGAAGAGAAAGGG + Intergenic
1074074958 10:110114681-110114703 CAAAGTAAGGAGAAGAGAGAAGG + Intronic
1074224045 10:111466377-111466399 CAAAACAGGGTGAAGAGATAGGG - Intergenic
1074513513 10:114141591-114141613 CAGAGGAGGGGGAAGAAATAGGG - Intronic
1075380854 10:122017400-122017422 CAAAGGAAGGAGAAGAACTAGGG - Intronic
1075476754 10:122742152-122742174 CAGAGTAAGAAGAAAAGAGATGG + Intergenic
1075819350 10:125292465-125292487 TGGAGCAAGGAGAAGAGCCAGGG - Intergenic
1076148679 10:128145644-128145666 CAGAGTAGGAAGAAGAGAGAAGG - Intergenic
1076169530 10:128307913-128307935 GTGAGCAAGAAGAAGAGAGAAGG - Intergenic
1076564107 10:131386559-131386581 CAGAGGGAGGAGCAGAGAGAGGG + Intergenic
1077695041 11:4386038-4386060 CAGAGCAGGGGGAACAGAGATGG - Intronic
1077815002 11:5678438-5678460 CAGAGATAAGAGAAGAGAAAGGG + Intronic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1079121695 11:17689804-17689826 CAGAGCAAGGAGGAGAGTAGAGG - Intergenic
1079260834 11:18878633-18878655 CAGATCTGTGAGAAGAGATATGG + Intergenic
1079362469 11:19780406-19780428 CAGAGCAAGGAGAAACAATGAGG + Intronic
1079558325 11:21789802-21789824 GAGAGCAAGGAGAAAAGTAAGGG - Intergenic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1079672716 11:23188422-23188444 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1080301988 11:30794810-30794832 CAGGACAAGGAAAAGAGATGGGG - Intergenic
1080495269 11:32811674-32811696 AAGAGCAAGCAGGAGAGACAGGG + Intergenic
1080695480 11:34600007-34600029 CAGGGCAGGCAGAAGAGAGAGGG + Intergenic
1081402466 11:42658972-42658994 AGGAGCAAGGAGAGGTGATAAGG + Intergenic
1081418970 11:42849568-42849590 CAGCGAAAAGAAAAGAGATAAGG + Intergenic
1082627217 11:55500725-55500747 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1082777100 11:57254222-57254244 CAGAGGAAGCAAAAGAGAAAGGG + Intergenic
1082782845 11:57300651-57300673 CACAACAAGGAGACGTGATAGGG + Intronic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1085127046 11:74008918-74008940 GAGAACAAGGAGAAGGGAGAGGG + Intronic
1085297898 11:75441239-75441261 CACAGCAGGGAGAAGAGCCACGG + Exonic
1085330427 11:75645193-75645215 CAAGGCAAGGAGAAGAGACCTGG + Intronic
1085682184 11:78587329-78587351 TAGAGCAGGGAGAAGGGATAGGG + Intergenic
1086032613 11:82378478-82378500 CAAAGGAGGGAGAAGAGATTTGG + Intergenic
1086168448 11:83807848-83807870 CAGAGCTAACATAAGAGATACGG + Intronic
1086229026 11:84546288-84546310 CAGAGCAGGAGGAAGAGAGAGGG - Intronic
1086434703 11:86769786-86769808 GAGAACAAGGGGAAGAGACAGGG - Intergenic
1086677500 11:89627081-89627103 AAGAGGAAGGACAAGAAATAAGG + Intergenic
1087177700 11:95110305-95110327 CAGAGCAAGGGGATGATATTGGG - Intronic
1087196764 11:95310759-95310781 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1087448448 11:98285832-98285854 CAGGGCAAGGTGAAGAAAGAAGG + Intergenic
1087788801 11:102385287-102385309 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1088138485 11:106586224-106586246 CAGATCAATGAGATGAGACAGGG + Intergenic
1088613508 11:111601925-111601947 TATAGCAACGAGAAGAGAAAAGG + Intergenic
1088749868 11:112834521-112834543 CAGAGGGAGAAGAAGAGATCAGG + Intergenic
1089348954 11:117810510-117810532 TAGAGAAAAGAGTAGAGATACGG - Intronic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1090471804 11:126987602-126987624 CAGAGAAAGGAGCATTGATATGG + Intronic
1090502236 11:127272765-127272787 CAGAGCAAGAGGAAGAGAGATGG + Intergenic
1090645961 11:128766838-128766860 CAGACCAAGGAGTTCAGATAAGG - Intronic
1090850747 11:130568846-130568868 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1091234125 11:134008381-134008403 CAGAGCAGGGAGAGGAGAGGTGG - Intergenic
1091446704 12:547910-547932 AAGAGCAAGGAGAAGGGATGAGG + Intronic
1092195660 12:6548342-6548364 CAGAGCAAGGAGAGGAGCGGGGG + Intronic
1092195851 12:6549339-6549361 AAGAGCAAGGAAAAGGGAAAGGG + Intronic
1092708023 12:11305862-11305884 AAGAGGAAAGATAAGAGATAGGG + Intergenic
1092789570 12:12059626-12059648 CAGAGAAAAGAGTAGAGACACGG - Intronic
1093150755 12:15618315-15618337 CAGAGCAAAGGGAAGGGATTAGG - Intergenic
1093578669 12:20764607-20764629 CAGAGAAAAGAGTAGAGACATGG - Intergenic
1093584665 12:20821483-20821505 CAGAGAAAAGAGTAGAGACACGG + Intronic
1094185456 12:27637677-27637699 CAAAGCAAGAAGAAGAGAGGAGG + Intronic
1094649444 12:32361218-32361240 GAGAGCAAGGAGACGAGTGAGGG + Intronic
1095092143 12:38117477-38117499 CAGAACAAGGAAAGGAGAGAGGG + Intergenic
1095308436 12:40665108-40665130 CATAGAAAGGAAGAGAGATAGGG - Intergenic
1095370813 12:41465181-41465203 TAGAGAAAGGAGTAGAGTTAGGG - Intronic
1096185517 12:49577969-49577991 CAGAGAATGGGGAAGACATATGG - Intronic
1096253990 12:50051794-50051816 GAGAGGAAAGAGAAGAGAGAAGG - Intergenic
1096597598 12:52706633-52706655 CAGAGCAGGGGGAAGAAGTAGGG + Intergenic
1096687848 12:53300482-53300504 CTAAGGAAGGAGATGAGATAAGG - Intronic
1096884799 12:54706476-54706498 CAGGGCAAGGAGAAGCAATGAGG - Intergenic
1096984412 12:55746499-55746521 AAGAGCAGGGAGAAGAGCCAGGG - Intronic
1097398439 12:59103067-59103089 CAGAGAAAAGAGTAGAGACATGG - Intergenic
1097417201 12:59327713-59327735 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1098402098 12:70086628-70086650 CAGAAAAAAGAGTAGAGATACGG - Intergenic
1098898087 12:76084948-76084970 CTCAGCAGGGAGAAAAGATATGG - Exonic
1099691520 12:85959406-85959428 GAGAGAAAGGGGAAGAGAAAAGG - Exonic
1099836258 12:87911908-87911930 CAGAGAAAAGAGCAGAGACACGG + Intergenic
1100501378 12:95177267-95177289 TCCAGCAAGGAGAAGGGATAAGG + Intronic
1100700014 12:97137458-97137480 CATAGAAAAGAGAAGAGTTAGGG - Intergenic
1100813533 12:98363521-98363543 CAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1100850576 12:98705939-98705961 GAGAGCGAGGCGAAGGGATAGGG - Intronic
1101239484 12:102824140-102824162 AAGAGCGTGGAGAAGGGATAGGG + Intergenic
1101685905 12:107020574-107020596 CAGAGCAGGAGGAAGAGAGAAGG - Intronic
1102426477 12:112848036-112848058 GAGAGCTAGGAGAAGAGAAAAGG + Intronic
1102520376 12:113474341-113474363 GACAGAAAGGAAAAGAGATATGG - Intergenic
1102529111 12:113533069-113533091 CAGAGCAGGGAGTAGAGCTGAGG - Intergenic
1103229906 12:119320693-119320715 CAGAGCAAGGTGAAGAAAAGTGG - Intergenic
1104475549 12:129067869-129067891 CAGAGAGAGGAGAAGAGACAGGG + Intergenic
1104635560 12:130436136-130436158 CAGGGCTAGGGGAAGAGATGTGG - Intronic
1105285278 13:18998358-18998380 CAGAGCCAGGAGAGGAGAAGCGG - Intergenic
1106915283 13:34507208-34507230 CAGAGAAAGAAGAAGAAAAATGG - Intergenic
1106943293 13:34799873-34799895 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1107192297 13:37604122-37604144 GAGAACAAGAAGAAGAAATATGG - Intergenic
1107683290 13:42871911-42871933 CAGAGAAAAGAGTAGAGACAGGG + Intergenic
1107726930 13:43308274-43308296 CAAAGAAAGGAGAAGTGAGAGGG - Intronic
1107750658 13:43562037-43562059 TGCAGCAAGGAGAAGAGATGGGG + Intronic
1108257640 13:48626132-48626154 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1109049322 13:57458276-57458298 AAGAGCAAGGAGAAGGGATGAGG + Intergenic
1109148024 13:58807280-58807302 AAGAGGAAGAAGAAGAAATAAGG - Intergenic
1109709808 13:66145836-66145858 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1109854793 13:68112334-68112356 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
1111079630 13:83286083-83286105 AAGAGCAAGCTGAAGAGATGAGG + Intergenic
1111415829 13:87942681-87942703 CAGAGCAAGGAGAGATGATGAGG - Intergenic
1111630300 13:90840673-90840695 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1111905856 13:94255537-94255559 GAGAGGAAGGAAAAGAGAGAGGG - Intronic
1112227687 13:97556197-97556219 TAGGGGAAGTAGAAGAGATATGG + Intergenic
1112229638 13:97575663-97575685 CAGAGCAAGAGCAAGAGAGAAGG + Intergenic
1112637166 13:101227678-101227700 CAGAGCCAGCAGATGAGACATGG - Intronic
1113324190 13:109266572-109266594 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1113643305 13:111973696-111973718 CAGAGAGAGGAGGAGAGAGATGG - Intergenic
1113809067 13:113126641-113126663 GAGACCAAGGGGAAGAGAGAAGG + Intronic
1115061580 14:29197762-29197784 CAAAGCAAACAGAACAGATAAGG - Intergenic
1115163668 14:30424093-30424115 GAGAGCAAGGAGAACAAATAAGG - Intergenic
1115395842 14:32907375-32907397 CAGAACAAGGAGAAGAGTAGAGG - Intergenic
1116139242 14:40968513-40968535 CAGAACAAGAGGAAGAGACAGGG - Intergenic
1116573310 14:46545155-46545177 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1116613363 14:47105386-47105408 CAGAGAAAAGAGTAGAGACACGG - Intronic
1116774076 14:49159593-49159615 CAGACTAAGGAGAAGAGAAGGGG + Intergenic
1116952767 14:50894400-50894422 CAGAGAAAAGAGTAGAGACATGG - Intronic
1117183322 14:53214614-53214636 CAGAGCAAGCAGCCGAGACAGGG + Intergenic
1117435997 14:55715776-55715798 CAGACAAAAGAGAAGAGATGGGG - Intergenic
1117484096 14:56176371-56176393 CAGAGCCAGCAGATGAGACATGG + Intronic
1118203686 14:63701616-63701638 GAGAGCAAGTAGAAGAGGTTAGG + Intronic
1118484099 14:66197455-66197477 CAGGGTAAGGAGAACACATAAGG + Intergenic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1118876560 14:69789971-69789993 CAGACCAGGGAAAAGAGAGATGG + Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119453652 14:74735334-74735356 CTGGGAAAGGAGGAGAGATAAGG + Exonic
1119843530 14:77811085-77811107 GAGAGCAAGGAGAAAGGGTAGGG + Intronic
1120124086 14:80719842-80719864 CGCAGCAAGGATAACAGATATGG + Intronic
1120770038 14:88369693-88369715 GAGAGCAAGCAGAAGAAAGATGG + Intergenic
1121057933 14:90876169-90876191 CAGAGCAATAAGAACAGAAAAGG + Intronic
1121688819 14:95859782-95859804 GAGAGCTAGGGGAAGAGCTAGGG + Intergenic
1122046015 14:99024397-99024419 AAAAGCAAGGAGAACACATAAGG - Intergenic
1202888435 14_KI270722v1_random:131506-131528 TAGAGCAAGGAACAGAGACATGG + Intergenic
1124199314 15:27663794-27663816 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1124561970 15:30782626-30782648 CTGGGAAGGGAGAAGAGATAAGG - Intergenic
1124664909 15:31583991-31584013 CAGAGCACAGAGATGAGATGAGG + Intronic
1125045625 15:35239998-35240020 CAGAGAAAAGAGTAGAGACACGG - Intronic
1125164772 15:36690006-36690028 CAGAGCCAGTTGTAGAGATAGGG + Intronic
1126097699 15:45100902-45100924 CAGAGCATGGGGTAGAGGTAGGG + Intronic
1126483062 15:49148738-49148760 CAGAATAAGGAGAAAAGTTAGGG + Intronic
1126812060 15:52416814-52416836 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1126912547 15:53431318-53431340 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1126977656 15:54202369-54202391 CAAAGCAAGAAGAACAAATATGG + Intronic
1128095675 15:64952843-64952865 AAGAAGAAGGAGAAGAGACAAGG - Intronic
1128108808 15:65063389-65063411 CAGAGCATGGAATAGAGATGGGG - Intronic
1128576242 15:68777191-68777213 CAGACAAAGGAGAGGAGAGAGGG - Intergenic
1129205874 15:74036707-74036729 CTGAGCAGGGAGAAGAAATCTGG - Intronic
1129547709 15:76415770-76415792 GAGAGTAAGGGGAAAAGATAGGG + Intronic
1130203591 15:81855231-81855253 AAGAGCCAGGGAAAGAGATAGGG - Intergenic
1130239310 15:82171000-82171022 AAAAGAAAGGGGAAGAGATACGG + Intronic
1130430677 15:83843887-83843909 CAGAGGGAGGAGGAGAGAGACGG + Intronic
1130735936 15:86548958-86548980 CAGAGCCAGGAAAAGAGTCAGGG + Intronic
1131247579 15:90808891-90808913 CAGAGCAAGGGCAAGAGCCAGGG - Intronic
1131532452 15:93205341-93205363 CAGACCAATGAGAATAAATAAGG + Intergenic
1131882659 15:96876311-96876333 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1132277750 15:100583714-100583736 AAGAGGAAGGAGAAAAGGTAGGG - Intronic
1132459060 16:41149-41171 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1133080680 16:3316951-3316973 TAGAGCAAGGGGAAGAGCCATGG + Exonic
1133765880 16:8837496-8837518 CAGAGAAAAGAGTAGAGACACGG + Intronic
1133895088 16:9919510-9919532 CATGGTAAGGAGAAGAGAAATGG + Intronic
1134042497 16:11079215-11079237 CAGAACAACCACAAGAGATAGGG - Intronic
1134323967 16:13189939-13189961 CAGAGGGAGGAGAAGAGAAGGGG + Intronic
1134618502 16:15670086-15670108 CAGAGCAAGGCGGGGAGATGGGG - Intronic
1135956808 16:26962777-26962799 CAGAGCCAGCAGATGAGATACGG - Intergenic
1137036158 16:35571806-35571828 CTCAGCAAAGAGAAGAGATTTGG - Intergenic
1138044346 16:53705220-53705242 CAGAGTAAGGAGAAAGGAAAGGG - Intronic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1139226064 16:65234318-65234340 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1139238548 16:65366378-65366400 CAGAGTAGGGAGGAGAGATAGGG - Intergenic
1139365464 16:66429677-66429699 CAGAGGAAGAAGAGGAGAGAGGG - Intronic
1139584159 16:67890712-67890734 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1139644130 16:68315547-68315569 CAAGGCTAGGAGAAGAGATGGGG - Intronic
1139680543 16:68558509-68558531 TGGAGCAAGGAGAAGAGCCATGG + Exonic
1139943193 16:70620941-70620963 CAGAGAAAAGAGTAGAGACACGG + Intronic
1140634264 16:76892680-76892702 CAGAGCAGGAACAAGAGAGAGGG - Intergenic
1141281823 16:82635901-82635923 CACAGCAAGCAGGAGAGAGAGGG - Intronic
1141448905 16:84083425-84083447 CAGAGAAAGGAGGAAAGAGATGG + Intronic
1141477673 16:84284478-84284500 AAGAGCAGGGAGCAGGGATATGG - Intergenic
1141865369 16:86746520-86746542 CAGAGAAAAGAGAAGAGACACGG + Intergenic
1141927344 16:87178232-87178254 CAGAGCTAGGAGGAGCCATAGGG + Intronic
1142108388 16:88318360-88318382 CAGAGCATGGAGAGGAGGAAGGG - Intergenic
1142541056 17:659797-659819 CTGAACAAGGAGTAGAGAGAAGG - Intronic
1143458362 17:7082784-7082806 AAGAGCAGGGATATGAGATAGGG + Intergenic
1143691319 17:8568579-8568601 CAGAGCAGGGAGAAAAAAAAGGG + Intronic
1143730599 17:8880676-8880698 CAGAGAAGGGAGCAGAGATCAGG + Exonic
1143743338 17:8970952-8970974 CTGAGGAAGGAGAAGACAAAAGG + Intergenic
1144057395 17:11555179-11555201 CAGAGCTTGGAGAGGAGAAAGGG + Intronic
1146390239 17:32415472-32415494 CAGAAAAAGGAGGGGAGATATGG + Intergenic
1146699261 17:34940543-34940565 CAGAGCAAAAAGAAGAAATATGG - Exonic
1146790339 17:35747284-35747306 CGGAGAAAGGAGAGGAGAGAAGG + Intronic
1147239366 17:39080479-39080501 AAGAGCAAGGAGAAAAGCTCTGG + Intronic
1147330040 17:39693226-39693248 AAGAGAAAGGAAAAGAGATGGGG - Intronic
1147808977 17:43153354-43153376 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1149295298 17:55256689-55256711 TAAAGCAAGGAGGAGAAATATGG - Intergenic
1149672944 17:58431635-58431657 CAGAGCATGGTAATGAGATATGG + Intronic
1149868898 17:60165632-60165654 CAGAGCCAGAAGCAGAGAGATGG - Intronic
1151053564 17:71006588-71006610 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
1151163914 17:72188145-72188167 CAAAGAGAGGAGAAGAGAGAGGG + Intergenic
1151268819 17:72977627-72977649 AAGAGCAAAGAGCAGAGAGAGGG + Intronic
1151426690 17:74035286-74035308 CAGAGCCAGCAGATGAGACATGG - Intergenic
1151743006 17:75996762-75996784 AAGAGAAAAGAGAAGAGAAAGGG + Intronic
1152326391 17:79641869-79641891 CAGAGCAAGAGGAAGAGAGAGGG - Intergenic
1152941500 17:83175106-83175128 CAGAGCAAGGAGGGGCGAGAAGG - Intergenic
1153102284 18:1487489-1487511 AAGAGGAAAGAGAAGAGACATGG + Intergenic
1153257995 18:3192078-3192100 CAGAGCAGGGAGAAGATGTTAGG + Intronic
1153580103 18:6564248-6564270 AAGAGCAAGGATAAGATACAGGG + Intronic
1153832919 18:8939011-8939033 CAGAGCAGGACGAAGAGAGATGG - Intergenic
1154280472 18:12997553-12997575 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1156354009 18:36325706-36325728 CAGAGTAAGAAGAAAAGAGAGGG - Intronic
1156573629 18:38286685-38286707 CAAAGCAAGGAGAATAGGTAAGG - Intergenic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1157193806 18:45603594-45603616 CAGAGGGAGGAGAATAGAAAAGG - Intronic
1157570041 18:48706137-48706159 CAGGGCAAGGGGATGAGAGAGGG - Intronic
1157728378 18:49982982-49983004 CAGAGAAAGGAGAAGATCTCTGG - Intronic
1158288533 18:55912709-55912731 CAGAGAAAGGAGAAAGGAAAGGG - Intergenic
1158336232 18:56416821-56416843 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1158437281 18:57442370-57442392 AAGAGGAAGGAAAAGAGAGATGG + Intronic
1158890379 18:61866655-61866677 CACAGCAGGGAGAGGAGACATGG - Intronic
1159097292 18:63918633-63918655 AAGAGCAAGGAAATTAGATAGGG + Intronic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1160382383 18:78470259-78470281 CAGAGCAGGAAGAATAGAGAAGG - Intergenic
1160697996 19:493904-493926 CAGATCAAGGAAGAGAGACAAGG - Intronic
1160758595 19:771537-771559 CAGAGGAGGGAGAGGAGAGAGGG - Intergenic
1161304706 19:3560647-3560669 GAAAGGAAGGAGGAGAGATAAGG + Intronic
1162696310 19:12478849-12478871 CAGCACGAGGAGAAGAGAGAAGG + Intronic
1162756100 19:12861039-12861061 CAGAGCAAGCCAAAGAGATAAGG + Intronic
1162802692 19:13119723-13119745 CAGGGCACAGAGAAGAGTTAAGG + Intronic
1162963865 19:14146341-14146363 AAGAGAAAGGAAAAGAGAAACGG - Intergenic
1163110346 19:15156819-15156841 CAGAGCACAGAGAAGAGTTGAGG + Intergenic
1163229121 19:15988021-15988043 GAGAGAAAGGAGCAGAGAGAAGG - Intergenic
1163870326 19:19815922-19815944 CAGAACAAAGAAAAGAGATGGGG + Intronic
1163906888 19:20155794-20155816 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1164010334 19:21197853-21197875 TTGGGAAAGGAGAAGAGATAAGG + Intergenic
1164073838 19:21794821-21794843 CAGAGCAAGAGGAAGAGAGTAGG + Intergenic
1164152821 19:22569457-22569479 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1164234941 19:23323610-23323632 AGGAGAAAGGAGAAGAGAAAAGG - Intronic
1164403716 19:27922614-27922636 GAGAGAAAGCAGAAGAGATGGGG + Intergenic
1164526370 19:29016409-29016431 GAGAGAAAGGAGGAGAGAGAGGG - Intergenic
1165298587 19:34950449-34950471 CAGTGCCATGAGAAGAAATAAGG + Intergenic
1165497153 19:36159883-36159905 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1165553708 19:36610686-36610708 TGGAACAAGGAGAAGAGCTATGG + Exonic
1165995262 19:39839600-39839622 CAAAGCCAGGAGAGAAGATACGG + Intronic
1166033503 19:40150538-40150560 CAGAGCAGGAGGAAGAGAGATGG - Intergenic
1166226622 19:41399732-41399754 GAGAGAAAAGAGAAGAGAAAAGG - Intronic
1166499084 19:43327970-43327992 CAGAGAAAAGAGTAGAGACATGG + Intergenic
1166881041 19:45930289-45930311 CAGAGGAAGGAGAATAGAGATGG - Intergenic
1167214983 19:48158587-48158609 CAGAGCAAGAAGAAGATTTGTGG - Intronic
1167373550 19:49099244-49099266 CAGAGCAGGGAGAAGAGACATGG - Intronic
1168051437 19:53832496-53832518 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1168252875 19:55150350-55150372 CACAGCAAGGTGCAGAGACATGG - Intergenic
1202663835 1_KI270708v1_random:98298-98320 TAGAGCAAGGAGCAGAGACATGG + Intergenic
925277184 2:2658602-2658624 CAGAGCCAGCAGGAGAGAGAGGG + Intergenic
925292451 2:2756662-2756684 CAGAGGCATGAGCAGAGATACGG + Intergenic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
925670499 2:6305053-6305075 CAGAGTAAGGGGCAGAGATGAGG + Intergenic
926245736 2:11121507-11121529 CTGAGGAAGGGGAGGAGATATGG - Intergenic
926629743 2:15125575-15125597 CGGAGCAAGGATTAGTGATATGG - Intergenic
926815698 2:16796436-16796458 CAGAGAAAAGAGTAGAGACACGG + Intergenic
927244370 2:20945209-20945231 CAGCAGAAGAAGAAGAGATATGG - Intergenic
927585879 2:24304752-24304774 TAGAGCAAACAGAAGAGAGAAGG + Intronic
928179838 2:29061235-29061257 GTGAGGAAGGAGAATAGATACGG + Exonic
928489836 2:31770454-31770476 CAGAAGAAGAAGAAGATATAAGG + Intergenic
928592896 2:32835344-32835366 GAGAGGAAGCAGAAGAGAGAGGG - Intergenic
928619845 2:33077504-33077526 CAGAGCAGGAGGAAGAGAGAGGG + Intronic
928857012 2:35814285-35814307 CAGAGAAAAGAGAGGAGAGAAGG - Intergenic
929027139 2:37615673-37615695 CAGGGGAACAAGAAGAGATAGGG + Intergenic
929119051 2:38468832-38468854 CAGATGAAGGTGAAGAGAAAAGG - Intergenic
929149052 2:38731613-38731635 CAGAGCAGGGACAAGATATAAGG - Intronic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
930928593 2:56852014-56852036 GAGAGAAAGGGGAAGAGATGAGG - Intergenic
930954950 2:57194201-57194223 CAGAGAAAAGAGTAGAGACACGG - Intergenic
931042537 2:58315324-58315346 CAGAGAAAAGAGTAGAGACACGG - Intergenic
931625629 2:64253762-64253784 CAGAGAAAAGAGTAGAGACATGG - Intergenic
931850276 2:66245163-66245185 CAGAGAAAAGAGTAGAGACATGG - Intergenic
931966135 2:67536862-67536884 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
931967697 2:67551600-67551622 GAGAGTAAGGAGAAGACATCAGG - Intergenic
932171971 2:69565621-69565643 CAGGGAAGGGAGAAGAGAAATGG + Intronic
932176241 2:69605385-69605407 CAGAGCAAGGAGAATGGTTAGGG - Intronic
932367791 2:71164163-71164185 CAGAGAAAAGAGTAGAGACACGG + Intergenic
932770105 2:74496294-74496316 CAGAGAAAGGGGAGGAGAAAGGG - Intergenic
933079128 2:77966338-77966360 CAGAGAAAAGAGTAGAGACACGG - Intergenic
934475306 2:94589504-94589526 CAGAGCAAGGAGAGGGGAATTGG - Intronic
934870134 2:97856825-97856847 CAAAGCAAGAAGAAGAAAAAAGG + Intronic
935333328 2:101993646-101993668 CAGAGAGAGGAACAGAGATAGGG - Intronic
935662856 2:105484907-105484929 CAGAGCCAGGAAATGAGACATGG - Intergenic
936247320 2:110839753-110839775 GAGAGCTATGAGAAGAGAAATGG - Intronic
936883195 2:117279972-117279994 CAGAGAAAAGAGTAGAGACACGG - Intergenic
937424809 2:121789899-121789921 CAGATGAAGGAGTAGAGAAATGG - Intergenic
937617230 2:123940454-123940476 CAGATCATGGAGAAGAAATGAGG - Intergenic
938594424 2:132772924-132772946 CAGTGAAAGGAGAGGAGAAATGG + Intronic
938780733 2:134582481-134582503 CAGAGCCAGCAAATGAGATATGG - Intronic
939334520 2:140808532-140808554 CAGATCAGGGAAAATAGATAAGG - Intronic
939379181 2:141412992-141413014 CAGAGCAAGGGGAAGACTTAAGG + Intronic
939470582 2:142615562-142615584 CAGAGCAAGCAGAAGCAATGTGG + Intergenic
939801673 2:146719115-146719137 AAAAGCAACGTGAAGAGATAGGG - Intergenic
939902472 2:147866956-147866978 CAGAGCAGGGAGAGAAGTTAAGG + Intronic
940852484 2:158701699-158701721 GAGAGAAAGGAGAAGAGAGAGGG - Intergenic
940932811 2:159455234-159455256 GAAAGCAAAGAGAAGAGATTTGG - Intronic
941344231 2:164348098-164348120 CAGAGCACTGAGAAGAAACATGG - Intergenic
941353239 2:164460347-164460369 CAGAGAAAAGAGTAGAGACACGG - Intergenic
941771120 2:169347117-169347139 CAGAGCAAGGTTCAGAGAGAAGG - Intronic
942003428 2:171673869-171673891 CAGGGCAAGGAGGAAAGAAAAGG + Intergenic
942431762 2:175919473-175919495 CAGATGAATAAGAAGAGATATGG - Intergenic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
942730441 2:179056258-179056280 CAGAGAAAAGAGTAGAGACACGG + Intergenic
942809577 2:179981954-179981976 CAGAGAAAGAGAAAGAGATACGG - Exonic
943822254 2:192340359-192340381 CAGAGAAAATAGAACAGATATGG + Intergenic
943994837 2:194749325-194749347 CAGAGAAAGGTGAAGATATAAGG + Intergenic
944038396 2:195325652-195325674 CAGAGAAAGCAGAAGATATATGG + Intergenic
944508746 2:200443572-200443594 CAAAGCAAGGAGAGGAGAAGAGG - Intronic
945394158 2:209300454-209300476 CAGAGAAAAGAGTAGAGACACGG - Intergenic
945554546 2:211262689-211262711 CAGAGAAAAGAGAGGAGAGAGGG - Intergenic
945736310 2:213605014-213605036 GAGAGAAAGGAAAAGAGATTTGG - Intronic
945898802 2:215515000-215515022 AAGAGGAAGGGGAAGAGAGAAGG + Intergenic
945916435 2:215709342-215709364 CAGAGTAAGCAGTAGAGAGAAGG - Intergenic
946215180 2:218178504-218178526 CAGAGAAAAGAGTAGAGACACGG + Intergenic
946353269 2:219169279-219169301 CAGAGCAAGGGCAAGGGGTAAGG - Exonic
946918660 2:224554071-224554093 AAGAGTGAGGAGAAGAGAGAAGG - Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947576956 2:231283151-231283173 CAGAGCAGGGAGAAAAAAGACGG + Intronic
947772586 2:232682354-232682376 CGGAGCAAGGTGAAGAGGGAGGG - Exonic
948390534 2:237608171-237608193 CAGAGAAAAGAGTAGAGACACGG - Intergenic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
1168896394 20:1326545-1326567 CACAACAAGGAAAAGAGAGAAGG - Intronic
1169525328 20:6418156-6418178 CAAAGGAAGGAAAAGAGAGAGGG + Intergenic
1169561180 20:6802647-6802669 GAGGGGAAGGAGAAAAGATAGGG - Intergenic
1169639793 20:7738530-7738552 CAGGGCAAAAAGAAGAGATAAGG - Intergenic
1169721471 20:8682132-8682154 TAGTGAAAGGAAAAGAGATAGGG + Intronic
1169852782 20:10070678-10070700 CAGAGTAGGAAGAAGAGAGAGGG + Intergenic
1170141996 20:13133727-13133749 CTGAGCCAGCAGACGAGATATGG + Intronic
1170820855 20:19755608-19755630 CAGAGAAAAGAGTAGAGACATGG + Intergenic
1170883706 20:20319537-20319559 CAGAGCAGGAGGAAGAGAGAAGG - Intronic
1171066208 20:22017972-22017994 CAGAGGGAGGAGAGGGGATATGG + Intergenic
1171100129 20:22375028-22375050 GAGGGAAAGGAGAAGAGAAAAGG - Intergenic
1171245186 20:23605058-23605080 CAGAGCAAGGAGCCCAGAGAAGG + Intronic
1172468061 20:35171869-35171891 CAGCCCAAGGAGAAGGGAAAAGG + Intergenic
1172617732 20:36300278-36300300 AAGAGCAAGGGGAAGACAGAGGG - Intergenic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1173101706 20:40094254-40094276 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1173118723 20:40270288-40270310 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1173376165 20:42485190-42485212 CAGAGAAAGGAAAAAAGATTTGG + Intronic
1173673998 20:44817973-44817995 CAGAGAAAGAAGGAGAGAAAGGG + Intergenic
1173890398 20:46504248-46504270 TGGAGCAAGGAGAAGAGCCATGG - Exonic
1174130651 20:48341475-48341497 GAGAGGAAGGAGAGGAGACAAGG - Intergenic
1175609957 20:60342584-60342606 CAGAGGATGGAGAGGAGAGAGGG - Intergenic
1176346129 21:5749497-5749519 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176352943 21:5870081-5870103 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176498698 21:7574958-7574980 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1176540450 21:8147567-8147589 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176559401 21:8330612-8330634 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1177044037 21:16147004-16147026 CAAAGAAAGGGAAAGAGATAAGG - Intergenic
1177216020 21:18130042-18130064 CGGAGCAAGGAGAAGGAATAGGG + Intronic
1177294970 21:19162211-19162233 CAGAGCAGGAGGAAGAGAGATGG + Intergenic
1177338672 21:19768168-19768190 GTGAAGAAGGAGAAGAGATAAGG - Intergenic
1177529565 21:22341891-22341913 CAGAGCAAGAGGAAGAGAAGAGG + Intergenic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1177653057 21:23982668-23982690 ATGAGGAATGAGAAGAGATACGG - Intergenic
1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG + Intergenic
1178014159 21:28323779-28323801 CAGAACAAAGAGAAAAGAGAGGG - Intergenic
1178264815 21:31133116-31133138 CTGAGCAAGGAGTTGAAATAAGG - Intronic
1178416631 21:32410534-32410556 CAGAGCAAAGGGAAGAGCCAGGG - Intergenic
1179337616 21:40472878-40472900 GAGAGAAACGAGAAGAGAAAGGG + Intronic
1180330557 22:11475182-11475204 TAGAGCAAGGAGCAGAGACATGG + Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182113796 22:27743205-27743227 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1182627590 22:31659372-31659394 TAGAGAAGGGAGAAGAGAGAAGG - Intronic
1183023489 22:35046134-35046156 CAGAGTAAGGAGATGAGAATGGG - Intergenic
1183175365 22:36220576-36220598 CAAAGCAAGCAGAAGAGAAAAGG + Intergenic
1184177236 22:42795267-42795289 AAGAACAAGGAGAGGAGAAAGGG - Intergenic
1184286718 22:43476164-43476186 CTGAGTAAGGATTAGAGATAAGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184575848 22:45365135-45365157 GATAGAAAGGAGAAGAGATCCGG - Intronic
1203245393 22_KI270733v1_random:63994-64016 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
949162252 3:895171-895193 CAGAGAAAAGAGTAGAGACACGG + Intergenic
949901808 3:8821361-8821383 CAGAGCAGAGAGAATGGATAGGG - Intronic
950080127 3:10216044-10216066 CAGAGGAGGGCGGAGAGATAAGG + Intronic
950417913 3:12878994-12879016 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
950926348 3:16745532-16745554 CAGAGAAAAGAGTAGAGACACGG - Intergenic
951017599 3:17747059-17747081 AAGAGCCAGGAGAAGGGATGTGG - Intronic
951072085 3:18341308-18341330 GAGAGCTAGGAGAAGGGAGAGGG - Intronic
951436696 3:22673334-22673356 CAGAGCAAAAGGAAGAGAGAGGG - Intergenic
951472075 3:23067355-23067377 CAGAGCAAGAGGAAGAGAGAAGG - Intergenic
951742698 3:25941834-25941856 AGGAGGAAGGAGAAAAGATAAGG - Intergenic
952023279 3:29048654-29048676 CAAAGCAAGGGTAAGAGAGAAGG - Intergenic
952043078 3:29283122-29283144 CAGAGCAAGGACAAGTTAAAAGG + Intronic
952275554 3:31872299-31872321 CAGAGCAAGGACAAGAAAGCAGG + Intronic
953052068 3:39353658-39353680 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
953497334 3:43399619-43399641 GAGGGCAAGGAGAAGAGAGATGG - Intronic
953840571 3:46387062-46387084 AAGAGAAGAGAGAAGAGATAAGG + Intergenic
954166591 3:48764122-48764144 AAGAGCACGGAGAAGATACATGG - Intronic
954285266 3:49614772-49614794 CAGAGCAAGGATAGGAAATAAGG - Intronic
954286366 3:49622255-49622277 AAGATCAAGGAGAGGATATAAGG + Intronic
954412851 3:50378539-50378561 CAGAGCAGGGGGCAGAGATGGGG + Intronic
954834126 3:53450143-53450165 AAGAGCAAGGAAAACAGATAAGG - Intergenic
954969413 3:54638976-54638998 CAGAGAAAAGAGTAGAGACACGG + Intronic
955024907 3:55158155-55158177 CAGAGCAAGGAAGAAAGATTAGG - Intergenic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
955476308 3:59340048-59340070 GAGAACAAGAAGAAGAGATGTGG + Intergenic
955812515 3:62806007-62806029 CAGAGCAAGGAAAAGCCATAAGG - Intronic
956048486 3:65222004-65222026 CATTGCAAGCAGCAGAGATATGG - Intergenic
956925251 3:73980035-73980057 AAGAGCAGGGAGAATACATAGGG + Intergenic
957017163 3:75080604-75080626 CAGAGAAAGTAGAACAGAGATGG + Intergenic
957092126 3:75741310-75741332 TAGAGCAAGGAGCAGAGCCATGG - Exonic
957519328 3:81298553-81298575 CTGATCAAGGACAAGAGAAATGG + Intergenic
958047453 3:88303207-88303229 GAGAGAAGGGAGAAGAGAGAAGG - Intergenic
958587650 3:96111034-96111056 TAGGGCAAGGGGAAGAGATGTGG - Intergenic
958821904 3:98984634-98984656 GAGAACAAGGAGAAGAGGCAGGG - Intergenic
961022367 3:123519022-123519044 CAGAGCAAGAGGAAGTGAGAGGG + Intronic
961164914 3:124757032-124757054 CAGAGAAAAGAGTAGAGACACGG + Intergenic
961498655 3:127315025-127315047 CAGAGCAAGAAAGAGAGAGAGGG + Intergenic
961505128 3:127365569-127365591 CAGAGCAGGAAGAAGAGCAAAGG - Intergenic
961711774 3:128833683-128833705 CAGAGAAAAGAGTAGAGACACGG + Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
962365588 3:134777335-134777357 CTGATCAAGGAGAAGAAATAAGG - Intronic
962459891 3:135600890-135600912 CAAAGGCAGGAGAAGATATATGG + Intergenic
964269663 3:154941438-154941460 TATAGAAAGGAGAAGAGACAAGG + Intergenic
964507171 3:157412050-157412072 CAGAGCAGGAGGAAGAGAGAGGG - Intronic
964527914 3:157634904-157634926 CAGAGCCAAGAGGAGGGATAAGG + Intronic
965956410 3:174375923-174375945 AAGACCAAGTAGAAGAAATAGGG + Intergenic
966441168 3:179946076-179946098 CAGAGCAATGAAGAGAGGTAAGG - Intronic
966489539 3:180512436-180512458 CAGTGGCAGGAGGAGAGATAAGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967561240 3:190921334-190921356 CAGAGAAAGCAGTAGAGACACGG - Intergenic
968280843 3:197475596-197475618 CAGAGAGAGGAAAAGAGAGAGGG + Intergenic
968360473 3:198143499-198143521 CAGCCCAAGGGGAAGAGACAGGG - Intergenic
969842322 4:9891661-9891683 CAGAGCAAGTAGGTGAGAGAGGG + Intronic
970676936 4:18461926-18461948 CAGAGCAGAGAGAAGAAAAATGG + Intergenic
970924868 4:21439667-21439689 CAAAGCAAGAAGAAGGGAGAAGG - Intronic
971055052 4:22903071-22903093 CAGAGCAGGAGCAAGAGATATGG + Intergenic
971123336 4:23726516-23726538 CAGAGAAAAGAGTAGAGACACGG + Intergenic
971180402 4:24324440-24324462 CAGAGAAAAGAGTAGAGACACGG - Intergenic
971268728 4:25117422-25117444 CTGAGCAAGGCGCAGATATAAGG - Intergenic
971393256 4:26205215-26205237 TTTAGCAAGGAGAAGAGATGTGG + Intronic
972034099 4:34498946-34498968 CAGAGCACTGAGAAAAGAAATGG + Intergenic
973153889 4:46923944-46923966 CTGAGGCAGGAGAAGAGATGAGG - Exonic
973670035 4:53207766-53207788 CCGAGAAAGAAGAAGAGAGAAGG - Intronic
974292621 4:59952457-59952479 CAGAAAAAGGTGAAGAGAGATGG - Intergenic
974439392 4:61897753-61897775 GAGAGGAAGGAGATGAGAAAAGG - Intronic
974702286 4:65467177-65467199 ATGAGCAAGGAAAAAAGATAGGG + Intronic
975029171 4:69592500-69592522 CAAAGCAAGAGGAAGTGATAAGG + Intronic
975360317 4:73461726-73461748 TAAAGAAAGGAAAAGAGATAAGG + Intergenic
975446711 4:74473982-74474004 TAAAGAAAGGAGAAGAGAGAGGG - Intergenic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976081453 4:81359600-81359622 CAGAAGAAGGAGGAGAGAAAAGG + Intergenic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976329135 4:83808563-83808585 CAGAGAAAGAAAAAGAGAAAGGG + Intergenic
976481131 4:85547122-85547144 CAGAGAAAGGAGACAATATAGGG - Intronic
976884730 4:89969292-89969314 CAGAGAAAAGAGTAGAGACACGG + Intergenic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
978085953 4:104654990-104655012 AAGAACAAGGAGAAGAGAGATGG + Intergenic
978162495 4:105565749-105565771 AAGAGCAGGTAGAGGAGATAAGG - Intronic
978764455 4:112390040-112390062 CTGTGCATGGAGAAGAGATGTGG - Intronic
978910871 4:114062174-114062196 CAGGGAGAGGAGGAGAGATAGGG - Intergenic
980286128 4:130781071-130781093 AAGAGGAAGGAGAAAATATAAGG + Intergenic
980314855 4:131185592-131185614 CAGAAGAGGCAGAAGAGATAAGG + Intergenic
980420853 4:132558967-132558989 AAAAGCAAGGAGAATAGTTATGG + Intergenic
980611922 4:135171776-135171798 CAGAGAAAAGAGTAGAGACACGG + Intergenic
981132178 4:141169235-141169257 CAGAGCAGGAAGAAGAAAAAAGG - Intronic
982180625 4:152745833-152745855 CAGAGAAAAGAGTAGAGACACGG + Intronic
983452184 4:167924111-167924133 CAGAGAAAAGAGTAGAGACACGG - Intergenic
983836140 4:172387743-172387765 CAGAAGAAGGTGAAGAGACAGGG - Intronic
984393761 4:179169374-179169396 CAGAGAAAAGAGCAGAGACACGG + Intergenic
984700514 4:182815733-182815755 CAGAGAAAAGAGTAGAGACACGG - Intergenic
984993207 4:185401992-185402014 CAGAGCTAGGCGAAGAGGTGAGG - Intronic
985060395 4:186072257-186072279 CGGAGCAGGAAGAAGAGAGAAGG + Intronic
985164648 4:187079596-187079618 CAAAACTAGGAGAAGAAATAAGG - Intergenic
985487233 5:158501-158523 CAGAGGGAGGAGGGGAGATAGGG - Intronic
985916726 5:2925797-2925819 CAGAGGAAGAAGAAGAGGAAAGG - Intergenic
986248461 5:6032357-6032379 CAGAGTGAGGAGATGAGATCAGG + Intergenic
986341231 5:6791104-6791126 CAGAGCAGGGAGAGGAGATGGGG - Intergenic
986616530 5:9623202-9623224 CAGAGTAAAAAGGAGAGATACGG - Intergenic
987230214 5:15886082-15886104 GAGAGCAAGAGGAAGAGAGAAGG + Intronic
987975748 5:25012817-25012839 CAGAGGAAGCAAAAGAGAGATGG + Intergenic
988351857 5:30118742-30118764 CTGAGGAAGGAGATGAGAAAAGG - Intergenic
988383718 5:30534153-30534175 TAGAGGAAGGAGAAGATAGAAGG - Intergenic
988721241 5:33881237-33881259 TACATCATGGAGAAGAGATATGG - Exonic
988789100 5:34590945-34590967 CAGAGGGAGGAAAAGAGATTAGG - Intergenic
988832831 5:35004220-35004242 CAGAACAAAGTGAAGAGTTAAGG - Intronic
989133205 5:38127402-38127424 CAGAGCACCTAAAAGAGATAAGG - Intergenic
989160249 5:38384117-38384139 GAGAGGAAGGAGAAGGAATAAGG + Intronic
989260203 5:39411010-39411032 CAGAGTAAGCAGATGGGATAAGG + Intronic
989368159 5:40679455-40679477 CCGAGAAAGGAGAAGAAATACGG - Intergenic
989405430 5:41056173-41056195 CAGGAAAAGGAGAAGAGACATGG + Intronic
989770141 5:45135166-45135188 GAGAGAATGGGGAAGAGATAGGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991650286 5:68845635-68845657 CAAAGCAAGGAGGAGAGGGAAGG + Intergenic
992199318 5:74368291-74368313 CAGAGGAAAGAGAACAGAGAAGG + Intergenic
992960685 5:81954487-81954509 CAGAGAAAAGAGTAGAGACACGG - Intergenic
993192565 5:84699695-84699717 CAGAGAAAAGAGTAGAGACACGG - Intergenic
993746034 5:91598250-91598272 CAGAGCATGGAGACGAGAAATGG - Intergenic
993836137 5:92822440-92822462 AAGGGCAAGGAGAAGAGAGCTGG + Intergenic
994104820 5:95935812-95935834 GAGAAGAAGAAGAAGAGATAAGG - Intronic
994193570 5:96896960-96896982 CATAGCAAGCAGAATAAATATGG - Intronic
994294994 5:98080264-98080286 CAGAGAAAAGAGTAGAGACACGG - Intergenic
994532690 5:100988738-100988760 CAGAGAAAAGAGTAGAGACACGG + Intergenic
994556776 5:101316118-101316140 CAGAGAAAAGAGTAGAGACACGG - Intergenic
994943654 5:106357568-106357590 CACAGCAAGGAGAAAATAGATGG - Intergenic
995023158 5:107389139-107389161 CAGAGCAACCAGGGGAGATAGGG - Intronic
995152396 5:108864425-108864447 CAGAGCAAAGAGCAGAGAAAAGG - Intronic
995273205 5:110246956-110246978 CCTAGCAAGGAGAAGAAATGGGG + Intergenic
996207132 5:120754817-120754839 AAGAGCAAGGTCAAAAGATATGG + Intergenic
996491745 5:124105994-124106016 TAGTCCAAGGAGAAGAGAGATGG + Intergenic
996494988 5:124144785-124144807 CAGTGCAAGAAGATGAGAAAAGG + Intergenic
996495454 5:124149693-124149715 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
996651333 5:125880455-125880477 CAGAGCAAGGAGAAAAAAAATGG + Intergenic
996782840 5:127207294-127207316 CAGAGCAGGGGCAAGAGAGAGGG - Intergenic
997908028 5:137839876-137839898 GAAAGTAAGGGGAAGAGATAAGG - Intergenic
997973250 5:138421865-138421887 GAGAGCAAGATGAACAGATAGGG - Intronic
998260000 5:140623204-140623226 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
998570611 5:143253598-143253620 CACAGAGAGGATAAGAGATATGG + Intergenic
998813677 5:145991444-145991466 TGGAGCAAGGGGAAGAGAGAGGG - Intronic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
998996542 5:147873386-147873408 CAGAGAAAAGAGTAGAGACACGG + Intronic
999173708 5:149616947-149616969 CAGAGTAAAGAGCAGAGACAAGG - Intronic
999350735 5:150868977-150868999 CAGAGCAATCAGAAAAGAGAAGG - Intronic
999585189 5:153082075-153082097 CAGAGGAGGGAGAGGAGAAAGGG + Intergenic
999594231 5:153184480-153184502 CAGAGCCAGGTAGAGAGATATGG + Intergenic
999619017 5:153454194-153454216 CAGAGAAAAGAGTAGAGACATGG + Intergenic
999846961 5:155493180-155493202 AAGATCAAGAAGTAGAGATAGGG + Intergenic
999900931 5:156086390-156086412 CAGAGCTAGCAGTAGAGAAATGG + Intronic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1000519562 5:162279876-162279898 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1000660101 5:163927847-163927869 CAGAGCAAAATGAAGAGAGAAGG + Intergenic
1000921027 5:167137283-167137305 GAGATCAAGGGGAAGAGATAAGG - Intergenic
1001198010 5:169691145-169691167 CAGAGCAGGAACAAGAGACACGG + Intronic
1001471533 5:172016842-172016864 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
1001773986 5:174315191-174315213 GACAGCAAGGTGAAGAGATGGGG + Intergenic
1002611117 5:180419225-180419247 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1003331651 6:5134853-5134875 GAGAGGAAGGAGAAGGAATAGGG - Intronic
1003517253 6:6827406-6827428 CAGAGGAGAGAGAAGAGAAAGGG + Intergenic
1003630618 6:7783033-7783055 CAGAGTAAAAATAAGAGATAGGG + Intronic
1004247991 6:13998638-13998660 GAGAGGAAGGAAAAGAGATAGGG + Intergenic
1004575075 6:16887168-16887190 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1005013191 6:21355442-21355464 CAGAGCCAGCAAAAGAGACATGG + Intergenic
1005145698 6:22687399-22687421 AAGAGTAAGGAGAATAAATAGGG - Intergenic
1005898062 6:30195257-30195279 GAGAGGAAGGAGAAGAGAAACGG + Intronic
1006264931 6:32913022-32913044 CATTGCAAGGAGAAGAAATTGGG + Intergenic
1006319868 6:33314012-33314034 CACAGCGAGGAGCAGAGACAGGG + Exonic
1006532195 6:34665453-34665475 CAGAGAGAGAAGGAGAGATATGG + Intronic
1006741310 6:36311016-36311038 AAGAGAAAGGAGCAGAGAGAGGG + Intergenic
1006744677 6:36333099-36333121 CAGAGAAAGAAGAAAAGAAATGG + Intronic
1007163141 6:39809055-39809077 CAGAGGAGGGAGTAGAGAGATGG + Intronic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1009286000 6:61818299-61818321 CAGAGACAGGGGAAGAGAAAAGG + Intronic
1009366300 6:62860571-62860593 AAGAGCCAGAAGAAGAGAGAGGG + Intergenic
1010466922 6:76178671-76178693 CAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1010577074 6:77544839-77544861 CTGAGCAGGGAGAAGTGAAAGGG + Intergenic
1010827067 6:80486919-80486941 CAGAGAAAAGAGTAGAGACATGG + Intergenic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1010964474 6:82188061-82188083 GAGACCAAGGAGAAAAGATATGG + Intronic
1011645671 6:89455684-89455706 CAGAGCAGGAGGAAGAGAGAGGG - Intronic
1011942758 6:92863302-92863324 CTAAACAAGGAGGAGAGATATGG - Intergenic
1012066692 6:94558430-94558452 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1012415817 6:99012206-99012228 CAGAGGAAGAAGAAGTGATATGG + Intergenic
1012769364 6:103409655-103409677 AAAAGAAAGGAGAGGAGATATGG + Intergenic
1013174863 6:107668632-107668654 AAGAGAAAGGAGAAGAGAAGAGG - Intergenic
1013189630 6:107791156-107791178 CAGAGCAAGAAGAACAGGGATGG + Intronic
1013419417 6:109952489-109952511 CAGAGCGAGGTGAAGGGAAATGG + Intergenic
1013477301 6:110520935-110520957 GAGAGCAGGTAGAAGAGAGAAGG - Intergenic
1014297394 6:119636987-119637009 CAGAGCAAGATGAAGTGATTTGG - Intergenic
1014682388 6:124447863-124447885 CAGAGAAAGGTGAAGACAGAGGG - Intronic
1014704789 6:124732298-124732320 AAGAGTAAGGAATAGAGATACGG + Intronic
1014718467 6:124891668-124891690 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1014891397 6:126849978-126850000 CAGAGAAAAGAGTAGAGACATGG - Intergenic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015199891 6:130567406-130567428 TAAAGAAAAGAGAAGAGATACGG + Intergenic
1015266587 6:131296683-131296705 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1015278003 6:131404038-131404060 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1016083775 6:139887155-139887177 CAGAAGAAGGAAAAGAGAGAGGG + Intergenic
1016164604 6:140924879-140924901 TAGAACAAGGGGAAGAGAGAGGG + Intergenic
1016265019 6:142222305-142222327 CAGAGGGAGAAGAAGAAATAAGG + Exonic
1016518660 6:144924413-144924435 CAGAGAAAAGAGTAGAGACATGG - Intergenic
1016722504 6:147318368-147318390 AAGAGCAAGGATAATAGTTAAGG + Intronic
1017263264 6:152412588-152412610 AAGGGCAAGGGGAAAAGATAAGG + Intronic
1017570943 6:155743314-155743336 TAGAGAAAGAAGAAGAGAGATGG + Intergenic
1018315403 6:162552075-162552097 CACAGCCATGAGAAGAGAGAAGG + Intronic
1018392811 6:163353303-163353325 CAGAGGCAGGAGAAGAGCTGTGG - Intergenic
1019034112 6:169040592-169040614 CAGAGAGGGGAGAAGAGAGAGGG + Intergenic
1019109799 6:169700827-169700849 CACAGCAGGGAGAGGAGGTAGGG - Intronic
1019259527 7:73134-73156 CAGCCCAAGGGGAAGAGACAGGG + Intergenic
1020287637 7:6697376-6697398 TGGAGCAAGGAGAAGAGCCATGG - Exonic
1020680154 7:11227020-11227042 CTGATCAAGGAGAGAAGATAAGG + Intergenic
1020820477 7:12960794-12960816 TAGAGAAAGGAGATGAGATGTGG + Intergenic
1020853338 7:13385257-13385279 CAGAGCAAGGAAATGAGGGAAGG + Intergenic
1021157846 7:17234178-17234200 CAGGGGAAGGAGATGAGACAGGG - Intergenic
1021611879 7:22465693-22465715 CAGAGCCAGCAAAAGAGACATGG + Intronic
1021954195 7:25807342-25807364 GAGAGGGAGGAGAAGAGATAGGG + Intergenic
1022019714 7:26386593-26386615 CAAAGCAGGGAGGAGAGATGGGG - Intergenic
1022033280 7:26511878-26511900 TAGAGCCAGGAGAAGGGAAAAGG + Intergenic
1022572937 7:31471538-31471560 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1022576274 7:31500031-31500053 TATAGCAAGGAGTAGAGAGAGGG + Intergenic
1022957995 7:35398992-35399014 CAGAGGAAGAAGCAGAGTTATGG - Intergenic
1023724899 7:43132766-43132788 CAGAGGAAGGGGAAGAGACCAGG - Intronic
1024611295 7:51066434-51066456 CAGAGTAGGGAGGAGGGATATGG + Intronic
1024697472 7:51871228-51871250 CAGAGAAAAGAGTAGAGACAGGG - Intergenic
1026038955 7:66850314-66850336 CTCAGAAAGGAGAAGAGATGTGG - Intergenic
1026226806 7:68449256-68449278 CAGAGAAAGAAGAGGAGAGAGGG - Intergenic
1026398571 7:69985288-69985310 GAGAGCAAGGAAAATAAATAAGG - Intronic
1027175650 7:75901526-75901548 CAGAGCCAGCAGATGAGACATGG + Intronic
1027547025 7:79540414-79540436 CAGAGAAGAGAGAAGAGAAAAGG - Intergenic
1028581671 7:92415531-92415553 CACTGCAAAGAGAAAAGATACGG + Intergenic
1028670359 7:93395147-93395169 CAGAGAAAAGAGTAGAGACATGG - Intergenic
1028792290 7:94866690-94866712 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
1028796669 7:94910270-94910292 CAGAGCAGGGGGAGGAAATATGG + Exonic
1029325703 7:99807132-99807154 CTGGGAAGGGAGAAGAGATAAGG + Intergenic
1030131810 7:106207910-106207932 CAGAGCAAGGAGACAGGAGAAGG - Intergenic
1031130726 7:117830502-117830524 AAGAGCAAGGAGGAAAGATTAGG - Intronic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1032486827 7:132294132-132294154 TAGAGCCAGGAGAGGAGATTGGG + Intronic
1033022145 7:137736470-137736492 CACAGCAACGTGAAGAGGTAAGG - Intronic
1033542722 7:142372265-142372287 CAGAGCAAGGGGATGAGTAAGGG - Intergenic
1033909613 7:146247859-146247881 CAGAGAAAAGAGTAGAGACACGG + Intronic
1035463269 7:159059656-159059678 AATAGCAAGGAGAAGGGATCTGG - Intronic
1037026114 8:14040260-14040282 CAGAGCAGGAAGAAGACATAGGG + Intergenic
1037289484 8:17335987-17336009 CAGAGGAGGGAGAAGAGAAGAGG + Intronic
1037733278 8:21547230-21547252 CACAGGAAGGAGATGAGAGAAGG - Intergenic
1038576895 8:28712280-28712302 GAGAGCAAGGGGAAGAGCGATGG + Intronic
1038671039 8:29583317-29583339 CAGAGCAAGGAATTGAGATAAGG + Intergenic
1038722259 8:30047422-30047444 CAGGGCAGGAAGAAGAGAGAAGG + Intergenic
1039286042 8:36041969-36041991 CAGAGCAGGGAGTAGAGTTAAGG + Intergenic
1039315845 8:36370822-36370844 CAGAACTAGGAGGAAAGATAAGG + Intergenic
1039400984 8:37269044-37269066 CAGAGCAAGGGAAAGGGAAATGG - Intergenic
1039666380 8:39535602-39535624 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1039699185 8:39944992-39945014 CAGAGCAAGGACTAGAGCTAAGG - Intronic
1040096203 8:43445558-43445580 CAGAGCCCGGAGTAGAGACAAGG + Intergenic
1041768099 8:61441466-61441488 AAGGGCAATAAGAAGAGATAAGG + Intronic
1042596804 8:70458171-70458193 CAGAGCCAGGAGAACACAGAGGG - Intergenic
1043222126 8:77679801-77679823 CAAAGCAAAGAGAAGAAAAATGG + Intergenic
1043353827 8:79390590-79390612 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1043508295 8:80924385-80924407 CATAGAAGGGAGAAGAGACAGGG + Intergenic
1043849707 8:85202288-85202310 CAGAGCACTGAGAAGAAAAAAGG - Intronic
1044068204 8:87723663-87723685 GAGAGAAAGGAGGAGAGAGAGGG + Intergenic
1044148659 8:88746699-88746721 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1044247064 8:89960858-89960880 CAAAGGAAGGAGGAGAGAAAAGG + Intronic
1044258769 8:90094691-90094713 CAGAGAAAAGAGTAGAGACACGG + Intronic
1044416936 8:91949229-91949251 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1044779847 8:95733078-95733100 CAGAGGGAGAAGAAGAGAGATGG + Intergenic
1045644635 8:104287169-104287191 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1046156083 8:110291722-110291744 CAGAGCCAGCAGCAGAGTTAGGG - Intergenic
1046467530 8:114625845-114625867 CAGAGCAAAAAGAAGAAATCTGG + Intergenic
1046481795 8:114829621-114829643 GAGAGCAAGGAGATGAAAAAAGG - Intergenic
1046511932 8:115213459-115213481 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1046559123 8:115815819-115815841 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1047484953 8:125320968-125320990 CAGAGCAGGAGGAAGAGAGAGGG + Intronic
1047872069 8:129094939-129094961 TGGAGCAATGAGAACAGATATGG + Intergenic
1047903841 8:129452042-129452064 CAGAGCAAAGTGAACAGATTTGG + Intergenic
1047946783 8:129888222-129888244 CAGAGCAGGAGGAAGAGAGATGG - Intronic
1048321415 8:133403582-133403604 CATAGCAGGGAGAAGTGAAAGGG + Intergenic
1048530082 8:135240001-135240023 CAGAGGTAGAAGAGGAGATATGG - Intergenic
1048585568 8:135771631-135771653 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1048640221 8:136349337-136349359 AAATGCAAGGAGAAGAGACATGG - Intergenic
1048766934 8:137854826-137854848 CAAAACAAAAAGAAGAGATAGGG - Intergenic
1049335939 8:142085330-142085352 AAGAGAAAAGAGAAGAGAGAGGG + Intergenic
1051052469 9:12949531-12949553 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1051085026 9:13338431-13338453 CAGAGGAAGGGGGAGAGAAAAGG + Intergenic
1051095988 9:13465631-13465653 CAGAAGAAGGAGAAGAGTAATGG + Intergenic
1051189118 9:14492559-14492581 CAGAGCAGGAAGAAGAGGGAGGG + Intergenic
1051207184 9:14700453-14700475 CAGAGGAAGGAGTTGAGAGATGG - Intergenic
1051397798 9:16644948-16644970 CAGAGAAAGTTGAAGAGTTAGGG - Intronic
1051453259 9:17222175-17222197 CACAGAAAGGAGCAGAGAAATGG - Intronic
1051849441 9:21490186-21490208 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1051892035 9:21952302-21952324 CAGAGCAGGAGGAAGAGAGAAGG + Intronic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1052312136 9:27078898-27078920 CAGAGGAAGGAGTGGAGATGAGG + Intergenic
1052838085 9:33266082-33266104 CAGATCAAGAAGATGAGAGAGGG + Exonic
1052854741 9:33400277-33400299 CAGAGCAAGGAGAGGGGAATTGG + Intronic
1053682761 9:40496558-40496580 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054280953 9:63128371-63128393 CAGAGCAAGGAGAGGGGAATTGG - Intergenic
1054295861 9:63332072-63332094 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054393878 9:64636567-64636589 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054428527 9:65141780-65141802 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054501852 9:65879765-65879787 CAGAGCAAGGAGAGGGGAATTGG - Intronic
1054818268 9:69496534-69496556 CAGAACAATGAGGAGAGAGAGGG - Intronic
1054837444 9:69692725-69692747 CAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1054911073 9:70455794-70455816 GGGAGGAAGGAGAAGAGAAAAGG + Intergenic
1055132276 9:72789632-72789654 CAGAGTTAGGAGAAGAGTCAGGG + Intronic
1055160081 9:73115727-73115749 CAGTGCAAAGACAAGAGAGAGGG - Intergenic
1055162650 9:73149473-73149495 CAAAACAAGGAGAGGAAATATGG - Intergenic
1055441286 9:76338905-76338927 CAGGGGAAGGAGAAGAGTCAAGG - Intronic
1056254370 9:84783656-84783678 AAGAGCATGGAGAAGAGAGAGGG + Intronic
1056856857 9:90138976-90138998 CACAGCCAAGAGAATAGATAGGG + Intergenic
1057983236 9:99683016-99683038 CAGAGCAAGAGGAAGAGAGATGG + Intergenic
1058612250 9:106789401-106789423 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1059176218 9:112172274-112172296 CAGAGCTAGTAGAGGAGAGAGGG - Intronic
1059453814 9:114387411-114387433 AAGAGCAAGGAGAGGAGCCAAGG - Intronic
1059567235 9:115395135-115395157 AAGCTCAAAGAGAAGAGATAAGG + Intronic
1059760811 9:117335770-117335792 CAGAGCAAGAAGAAAAAAAAAGG + Intronic
1059863641 9:118490170-118490192 CAGAGAAAAGAGTAGAGACATGG + Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061571856 9:131482731-131482753 CAGAGCAAGGAGCACAGACCAGG + Exonic
1062245667 9:135564843-135564865 CAAAGCAAGGAGCTGATATAGGG + Intronic
1062628004 9:137451744-137451766 TAGATCAAGGAGAAGAGACGTGG - Intronic
1203461730 Un_GL000220v1:47066-47088 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1185648028 X:1628881-1628903 CAGACCGAGGAGAAGAGAGGAGG - Intronic
1185858707 X:3558796-3558818 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1185990907 X:4892815-4892837 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1186081638 X:5939689-5939711 CATAACAAAGAAAAGAGATAAGG + Intronic
1186257238 X:7735827-7735849 CAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1187131254 X:16505313-16505335 GGGAGAAAGGAGAAGAGAGAAGG - Intergenic
1187246105 X:17554062-17554084 CACACTAAGGAGAAGAGCTAAGG + Intronic
1187303739 X:18076448-18076470 CTGAGCAAGTATAAGATATATGG - Intergenic
1187518709 X:19994941-19994963 CAGAGCAAGCCTAAGAGAAACGG + Intergenic
1187699717 X:21953478-21953500 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1188168859 X:26895928-26895950 CTAAGCAAGGAAAAGAGAGAGGG + Intergenic
1188236659 X:27739915-27739937 CAGAGAAAGGAGAATAAATCTGG + Intronic
1188400195 X:29734917-29734939 CAGAGCAAGAAGAGAAAATAAGG - Intronic
1189379892 X:40495146-40495168 CAGACCCAGGAGGAGAGAGAGGG - Intergenic
1189585503 X:42457026-42457048 AAGAGAAAGGAGAGGAGAAAAGG - Intergenic
1190004814 X:46725655-46725677 CAGATCAAGAAGATGAGAGAGGG - Intronic
1191017132 X:55820741-55820763 CAGAGCAGGAAGAAGAGAGCAGG + Intergenic
1192070958 X:67940936-67940958 CAGAGCAGGAGGAAGAGAGATGG + Intergenic
1192696549 X:73422236-73422258 CAGAGCATTGAGAAGAAACATGG - Intergenic
1192891986 X:75399727-75399749 CAGAGCACTGAGAGGAAATATGG + Intronic
1193093975 X:77527341-77527363 GAGAGCAAGGAGAAGGGCTACGG + Intronic
1193224899 X:78971173-78971195 CAGAGCAGGGACAAGAGAGAGGG + Intergenic
1193271370 X:79533436-79533458 CAGAGCAAAGAGAAAACTTATGG - Intergenic
1193542290 X:82787347-82787369 CAGATCTAGAAGAAGAGAGATGG - Intergenic
1193608585 X:83600036-83600058 CAAAGTAAGGAGAAAAGAAAAGG + Intergenic
1193790749 X:85812986-85813008 CACAGAGAGGATAAGAGATATGG - Intergenic
1194186395 X:90777802-90777824 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1194293768 X:92104713-92104735 CAGAGAAAAGAGTAGAGACATGG + Intronic
1194351137 X:92825713-92825735 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1194597092 X:95871762-95871784 CAGAGCAATCAGACAAGATAAGG + Intergenic
1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG + Intronic
1195123701 X:101783203-101783225 CAGAGCAAAGAGAGGAGAATGGG - Intergenic
1195724282 X:107898120-107898142 GAGAGCAAGGTGAAGAGAGAAGG - Intronic
1195733045 X:107984835-107984857 CACAAGAAGCAGAAGAGATAAGG - Intergenic
1196108868 X:111925076-111925098 CAGATATAGGAGAAGAAATATGG + Intronic
1196403772 X:115343463-115343485 CACAGCAAGTACAAGAGAAAGGG + Intergenic
1196533681 X:116816947-116816969 CAGAGAAAAGAGTAGAGACACGG + Intergenic
1196572353 X:117280388-117280410 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1196692225 X:118572024-118572046 CAGAGCAGTGAGAAGAGACAGGG + Intronic
1196867120 X:120080238-120080260 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1196874626 X:120146541-120146563 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1196875979 X:120156044-120156066 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1196934205 X:120713423-120713445 CAGAACAGGAAGAAGAGAGAAGG - Intergenic
1197384374 X:125785595-125785617 AAGAGCAGGGTGAAGAGAGACGG + Intergenic
1197611829 X:128647956-128647978 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
1197822854 X:130559190-130559212 GAGATCAAGGAGAAGAAACAAGG + Intergenic
1197825591 X:130587090-130587112 CAGTGTAAGAAGAAGAGATTAGG + Intergenic
1198748243 X:139912352-139912374 GAAGGCAAGGAGAGGAGATAGGG + Intronic
1199237066 X:145504419-145504441 AAAAGCAAGGAGAAGAGATGAGG + Intergenic
1199296372 X:146163324-146163346 GAGAGGAAGCAGGAGAGATATGG - Intergenic
1199610937 X:149612968-149612990 CAGTGGAAGCAGAAGCGATATGG - Intronic
1199665763 X:150095310-150095332 CAGAGTCTGGAGAAGAGACAGGG + Intergenic
1199769601 X:150966167-150966189 CTGAGCAGGGAGACGAGTTAAGG + Intergenic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200319622 X:155173725-155173747 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1200659463 Y:5942393-5942415 CAGAGAAAAGAGTAGAGACACGG - Intergenic
1201268102 Y:12228247-12228269 CAGGGCAAAGAGAACAGCTAGGG + Intergenic