ID: 1079633355

View in Genome Browser
Species Human (GRCh38)
Location 11:22705845-22705867
Sequence TTAGGTCCTCCTCTTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079633355_1079633360 25 Left 1079633355 11:22705845-22705867 CCTCCTTTAAGAGGAGGACCTAA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1079633360 11:22705893-22705915 AGATTATTCTGAAGCAGAATGGG 0: 1
1: 0
2: 1
3: 20
4: 216
1079633355_1079633358 -5 Left 1079633355 11:22705845-22705867 CCTCCTTTAAGAGGAGGACCTAA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1079633358 11:22705863-22705885 CCTAAATTAGTCATGTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 139
1079633355_1079633359 24 Left 1079633355 11:22705845-22705867 CCTCCTTTAAGAGGAGGACCTAA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1079633359 11:22705892-22705914 TAGATTATTCTGAAGCAGAATGG 0: 1
1: 0
2: 1
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079633355 Original CRISPR TTAGGTCCTCCTCTTAAAGG AGG (reversed) Intronic
901607029 1:10467192-10467214 GGAGGTCCTCCTCTGATAGGAGG + Exonic
902111464 1:14082313-14082335 GCATGTCCTCTTCTTAAAGGAGG + Intergenic
908839709 1:68266719-68266741 TTAGGTACTTCTCTAAAGGGTGG - Intergenic
908897621 1:68918234-68918256 TTAGGACCTCCCCTTACTGGAGG + Intergenic
909293688 1:73916246-73916268 TTAGCCTCTCCTCTTCAAGGAGG + Intergenic
909549126 1:76878427-76878449 TGAGGTCCTCCCATTAAAGTAGG - Intronic
912943984 1:114069450-114069472 TGTGGTCCTCCTGTTAAAGTAGG - Intergenic
915468997 1:156114659-156114681 ATAGGTCCTCCTCTGAAGGGAGG - Intronic
916691428 1:167193685-167193707 TTAAAACCTCCTCTTAAAGTTGG - Intergenic
918434609 1:184498599-184498621 TTAGGTCCTCCTGATGATGGTGG + Intronic
923498596 1:234545779-234545801 TTATTTCCTCCTCTTGGAGGTGG - Intergenic
1066605835 10:37169526-37169548 TTAGGGTCTCCTGTTAAAGATGG + Exonic
1066606618 10:37181318-37181340 TTAGGGTCTCCTGTTAAAGATGG + Intronic
1066649637 10:37642426-37642448 TTATGTCCTTCCCTTCAAGGTGG + Intergenic
1072251335 10:93584613-93584635 TTAGGTCCACCTGTTGATGGTGG - Intronic
1072830117 10:98648461-98648483 TGATTTCCTCCTCTTAAAGAGGG - Intronic
1074368295 10:112877881-112877903 GTATGTCCTCCTCTTCAAAGAGG - Intergenic
1078921218 11:15832406-15832428 TTAGGTGCTGCTCATAAAAGAGG - Intergenic
1079633355 11:22705845-22705867 TTAGGTCCTCCTCTTAAAGGAGG - Intronic
1080103233 11:28483794-28483816 TTAGCACCTCCTCTTAGAGCAGG - Intergenic
1081521019 11:43881031-43881053 TTAGATCCTTCTCTTTAAGGAGG - Exonic
1083989577 11:66238757-66238779 TTAGATCCTCCTGTTAAAGCAGG - Intronic
1085120406 11:73964070-73964092 TTAGCTCTTCATCTTAATGGTGG + Intronic
1092381210 12:7998572-7998594 TGTGGTCCTCCAATTAAAGGAGG + Intergenic
1098999663 12:77164625-77164647 TTAGGTCTTCCTCTTACTGATGG + Intergenic
1103362548 12:120362393-120362415 TTAGGGTGTCCTCTGAAAGGTGG - Intronic
1103970010 12:124664665-124664687 ACAGGTCCTTCTCTTAAAAGAGG + Intergenic
1107163351 13:37256798-37256820 TTAGTGTCTGCTCTTAAAGGTGG + Intergenic
1110703500 13:78577587-78577609 CTGGGCCCACCTCTTAAAGGAGG - Intergenic
1113184136 13:107667336-107667358 ATAGGATCTCCTCTTATAGGAGG - Intronic
1113696462 13:112349573-112349595 TGAGCTCCGGCTCTTAAAGGTGG - Intergenic
1115059535 14:29172620-29172642 TGAGGTCCTCCAGTTAAAGTAGG + Intergenic
1115130529 14:30047980-30048002 TTTGGTCCTCCAGTTAAAGTAGG + Intronic
1118273013 14:64360996-64361018 GTTGGTCTTCTTCTTAAAGGAGG - Intergenic
1119725126 14:76917733-76917755 TCAGGTCCTCATCCTAAATGAGG - Intergenic
1120845382 14:89120493-89120515 TTAGGTTCTACTCTTAGAGGAGG - Intergenic
1125062459 15:35440477-35440499 TAAGGTTCCCCGCTTAAAGGGGG - Intronic
1125475303 15:40044217-40044239 CTACGTCCTCCTCGTCAAGGTGG + Intergenic
1127717978 15:61669159-61669181 CTAGGTCCTTCTCATAAATGAGG + Intergenic
1129773524 15:78218097-78218119 TTAGGTACTCCTCTCCTAGGAGG + Intronic
1131675153 15:94663652-94663674 TTAAGGACTCCTCTTAAAGAGGG - Intergenic
1134347801 16:13407385-13407407 TTAGGGCCTCTTTTTAAGGGCGG + Intergenic
1134388959 16:13800886-13800908 TAATGTCCTGCTCCTAAAGGTGG + Intergenic
1134587640 16:15425839-15425861 GTATGTATTCCTCTTAAAGGAGG - Intronic
1135576191 16:23587693-23587715 TTGGGTCAGCCTATTAAAGGTGG - Intronic
1136107139 16:28038048-28038070 TTAGCTCCTCATCTGTAAGGTGG - Intronic
1138505896 16:57478177-57478199 TTTGCTCTTCCTCTGAAAGGGGG - Intronic
1146516521 17:33493957-33493979 TAAGATACTCCTCTCAAAGGTGG + Intronic
1155843195 18:30671419-30671441 TTAGGTCTTTTTCTTAAAAGAGG + Intergenic
1162855504 19:13465231-13465253 TTAGTTCCTTTTCTTCAAGGAGG + Intronic
1166001813 19:39881935-39881957 TTGGTCCCTCCTCTTCAAGGAGG - Intronic
928438724 2:31273633-31273655 TTAGCTCCTTGTCTTCAAGGAGG - Intergenic
930456431 2:51613047-51613069 TGTGGTCCTCCTGTTAAAGTAGG - Intergenic
936780444 2:116026561-116026583 TTCTGTCCTCCACATAAAGGTGG + Intergenic
936901262 2:117484542-117484564 TTGTGTCCTTCTCTTCAAGGTGG + Intergenic
937552205 2:123108040-123108062 CTATGTCCTACTCTTCAAGGTGG + Intergenic
939872763 2:147543192-147543214 TTTGGTCCTCATCAGAAAGGAGG + Intergenic
940268422 2:151864891-151864913 TTATGTCCTACTCTCAAAAGTGG + Intronic
946068578 2:217011421-217011443 TTGGCTCCTCCTCAGAAAGGTGG + Intergenic
946790757 2:223298481-223298503 TGTGGTCCTCCAGTTAAAGGAGG + Intergenic
948940881 2:241195713-241195735 TCAGGTCCTCCTCCCAAACGAGG - Exonic
1169263492 20:4154020-4154042 TGAGGTCCTCCTCCCAGAGGAGG + Intronic
1173094786 20:40015082-40015104 TGAGCCCCTCCTCTTAAAGAGGG - Intergenic
1178689962 21:34742650-34742672 TTATTTCCTCCTCTAAAAGATGG - Intergenic
1178763989 21:35432211-35432233 TGTGGTCCTCCAGTTAAAGGAGG - Intronic
959377515 3:105604124-105604146 TGTGGTCCTCCAGTTAAAGGAGG - Intergenic
962855130 3:139338358-139338380 CTAGTTCCTCCTCTTTAAGATGG - Intronic
963870265 3:150408600-150408622 CTCGGTCCTCCCCTTACAGGGGG - Exonic
964095136 3:152922554-152922576 TAAGGTCCACCTCTTACAGAGGG - Intergenic
965932355 3:174060450-174060472 TTAAGTCCTACTGTTCAAGGAGG - Intronic
975701662 4:77073486-77073508 TTAGTTCCTCTTCTGAAAGGAGG + Intronic
981103341 4:140854660-140854682 TTAGCTCTTTGTCTTAAAGGAGG + Intergenic
984983635 4:185306406-185306428 TTTGGTGCTCCGCTTAAATGTGG - Intronic
986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG + Intergenic
987111734 5:14693981-14694003 TTGGTTCCTCCTCTGAAAGCAGG - Exonic
988990760 5:36668508-36668530 GTAGGTCCTTCCCTTAAAGGAGG - Intronic
990038000 5:51346071-51346093 ATAGGTCTTCCTCTTAAAGATGG + Intergenic
997748293 5:136319169-136319191 TAAGGTCCTCATCTGAGAGGAGG - Intronic
999479419 5:151933143-151933165 TTAGCTCCACCTCCTAGAGGAGG + Intergenic
1000641946 5:163713171-163713193 TTTGATACTCCTCTGAAAGGAGG + Intergenic
1002952174 6:1824692-1824714 CTAGGGCCTCCTTTTAAAGCAGG + Intronic
1003088742 6:3083104-3083126 TTTGCTCCACATCTTAAAGGAGG - Exonic
1009333518 6:62456386-62456408 TTAGGTCCTCATCTTGTGGGTGG - Intergenic
1012536741 6:100307802-100307824 TGAGGTCCTCCTATTCCAGGTGG - Intergenic
1014472446 6:121833457-121833479 TTACCTCCTGCTCTTACAGGTGG - Intergenic
1015425901 6:133066963-133066985 GTAGGTCCACCTTTTCAAGGTGG - Intergenic
1024556772 7:50610412-50610434 TTAGGTACTATTCTTATAGGAGG - Intronic
1030517435 7:110555528-110555550 TAATGTCCTCCTCTTGAGGGTGG + Intergenic
1030523084 7:110622094-110622116 TTATCTCTTCCTCTTAAATGGGG - Intergenic
1030716226 7:112811060-112811082 TCCCGTCCTCCTCTTAAAGCTGG + Intergenic
1033685974 7:143641810-143641832 CTAGGTCCTTCACTTAAATGGGG + Intronic
1033689768 7:143725505-143725527 CTAGGTCCTTCACTTAAATGGGG - Intronic
1033698639 7:143815811-143815833 CTAGGTCCTTCACTTAAATGGGG - Intergenic
1035430263 7:158814832-158814854 TTAGCTCCTCCTCTGAAGAGCGG + Intronic
1044487325 8:92768413-92768435 TTTGGTCCTCCAGTTAAAGTAGG - Intergenic
1046156756 8:110301118-110301140 TTAGGTTCTACTCTTAAAATTGG + Intergenic
1048238821 8:132720287-132720309 TAAGCTCCGCCTCTTAAGGGAGG + Intronic
1049134574 8:140884290-140884312 TTAGGTTCTCCTCTTTAACATGG + Intronic
1049997665 9:1047170-1047192 TGAGGTCCCTCTCTTAAAAGGGG - Intergenic
1050502268 9:6311309-6311331 TCAGGTCTTCCTGTTAAAGATGG + Intergenic
1053034258 9:34810565-34810587 TCAGGTCCTCCTTTTCTAGGGGG - Intergenic
1055551633 9:77436965-77436987 TCAGGGCCTCCTCTCAGAGGAGG + Intronic
1058502950 9:105640211-105640233 ATAGGTCCTGTGCTTAAAGGAGG + Exonic
1061348425 9:130044320-130044342 TTAGCTCCACCTTTTAATGGAGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062179673 9:135184579-135184601 TTAGGTGCTCTTCTTAGAGCAGG - Intergenic
1186357844 X:8806074-8806096 TCAGATTCTCTTCTTAAAGGGGG + Intergenic
1192826641 X:74704287-74704309 TTGTGTCCTCCCCTTCAAGGTGG + Intergenic
1193446997 X:81617491-81617513 TCAGGTCCTCCAGTTAAAGTAGG + Intergenic
1193877120 X:86874025-86874047 TTTGGTCCTCCAGTTAAAGTAGG + Intergenic
1194032165 X:88831143-88831165 TGTGGTCCTCCACTTAAAGTAGG - Intergenic
1194841896 X:98753577-98753599 TGAGGTCCTCCCCTTTATGGTGG + Intergenic
1194886997 X:99328597-99328619 TTTGGTCCTTCTCTAGAAGGTGG + Intergenic
1198933847 X:141886561-141886583 TTTGGTCCTCCAGTTAAAGTAGG + Intronic
1199044883 X:143158038-143158060 CTCGCTCCTCCTCCTAAAGGTGG + Intergenic