ID: 1079635912

View in Genome Browser
Species Human (GRCh38)
Location 11:22740092-22740114
Sequence CTTTCCTCCAGCTCCGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079635910_1079635912 -9 Left 1079635910 11:22740078-22740100 CCTTTAAGAATCACCTTTCCTCC 0: 1
1: 0
2: 1
3: 18
4: 212
Right 1079635912 11:22740092-22740114 CTTTCCTCCAGCTCCGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 164
1079635908_1079635912 6 Left 1079635908 11:22740063-22740085 CCCAATTAGAAAATGCCTTTAAG 0: 1
1: 0
2: 4
3: 26
4: 357
Right 1079635912 11:22740092-22740114 CTTTCCTCCAGCTCCGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 164
1079635909_1079635912 5 Left 1079635909 11:22740064-22740086 CCAATTAGAAAATGCCTTTAAGA 0: 1
1: 0
2: 1
3: 30
4: 359
Right 1079635912 11:22740092-22740114 CTTTCCTCCAGCTCCGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079635912 Original CRISPR CTTTCCTCCAGCTCCGAGTC TGG Intronic
900561520 1:3309393-3309415 CTTCCCTCCTGCTCCCGGTCAGG + Intronic
901794145 1:11670895-11670917 CTTTTCTCCAGCTGCGTGTTAGG + Intronic
902363066 1:15952664-15952686 CTTTCCTCCAGCTCGGTGACTGG - Intronic
903134711 1:21302027-21302049 CTTTCCTGCAGCTCCACATCAGG - Intronic
904830110 1:33300802-33300824 CTTTCTTCCTTCTCCAAGTCTGG - Intergenic
904873934 1:33639098-33639120 CTTTCCTCCTTCTCTCAGTCTGG + Intronic
905242540 1:36590125-36590147 CCTCCCTCCAGCTCCGGGTTAGG - Intergenic
905243994 1:36599806-36599828 CTTTCCTCCAGTGGCGACTCAGG - Intergenic
905483095 1:38275157-38275179 ATTTCCTCCAGCTCTGATCCGGG + Intergenic
907343220 1:53752409-53752431 CCTTGCTCCCGCTTCGAGTCAGG - Intergenic
907704238 1:56819293-56819315 CTTTCCTCCAAGGCAGAGTCAGG + Exonic
913960692 1:143336373-143336395 CTTTCCTCCTGCCCCGAGACTGG + Intergenic
914055046 1:144161945-144161967 CTTTCCTCCTGCCCCGAGACTGG + Intergenic
914124100 1:144804416-144804438 CTTTCCTCCTGCCCCGAGACTGG - Intergenic
915838863 1:159199740-159199762 CTTTCTTCCAGACCCCAGTCCGG + Exonic
916481436 1:165218203-165218225 CGTTCTTCCAGCTCTGACTCTGG + Intronic
920248050 1:204603055-204603077 ATGTCCTCCAGTTCTGAGTCAGG - Intergenic
920333076 1:205226314-205226336 CTTTCCTTCGGCTTCGAGTCAGG + Intergenic
920333567 1:205228944-205228966 CTGTCTTTCAGCTCCGTGTCAGG + Intronic
922176609 1:223202417-223202439 CTTTCCTACCGCTCCCAGTCTGG + Intergenic
1063503224 10:6573456-6573478 CTTTCCTGAACCTCCGAATCAGG + Intronic
1066518439 10:36189646-36189668 CTTTCCTCTAGCACAGAGCCTGG - Intergenic
1067029132 10:42868627-42868649 CTTTCCTCCTGCCCTGAGGCTGG + Intergenic
1067831514 10:49613587-49613609 CTGTCCTCGATCTGCGAGTCGGG + Intronic
1067938261 10:50629888-50629910 CTTTGCTGCAGCTCTGAGGCAGG - Intergenic
1072870751 10:99117337-99117359 CTTTAGTTCAGCTCCGAGTTTGG - Intronic
1076256027 10:129025609-129025631 CTTTGTTCCAGCTACAAGTCAGG + Intergenic
1077556187 11:3227234-3227256 CTTTTCTGAAGCTCCGAGTGAGG + Intergenic
1079350304 11:19686315-19686337 CCTTCCTGGAGCTCCCAGTCTGG - Intronic
1079635912 11:22740092-22740114 CTTTCCTCCAGCTCCGAGTCTGG + Intronic
1080418561 11:32091317-32091339 CGCTCGCCCAGCTCCGAGTCGGG - Exonic
1081462965 11:43288693-43288715 CTTTCCTCCATCTCCTTCTCTGG - Intergenic
1082821599 11:57547816-57547838 CCTTCCCACAGCTCCCAGTCTGG + Intronic
1083814550 11:65125323-65125345 CTTTCCTTCAGCTTGGAGTCAGG - Intronic
1084197237 11:67530456-67530478 TGTTCCTCCAGCTGTGAGTCAGG + Intergenic
1085341137 11:75732351-75732373 CTTCCCTCCAGCTTCTAGTTGGG - Intronic
1085688525 11:78647340-78647362 CTTCCCACCAGCTCCAAGCCAGG - Intergenic
1085844157 11:80046620-80046642 CTTTCCTCCTTCTCTGAATCAGG + Intergenic
1087820176 11:102702804-102702826 CTTTCCTCCTGGTCCGGGTCTGG - Exonic
1091217652 11:133913052-133913074 CATTCCTCAGGCTCCGAGTTGGG - Intronic
1092165462 12:6339944-6339966 CTTTCCTCCAGCTCCAGGCCAGG + Intronic
1093272177 12:17077206-17077228 CTTTCCACCAGAGCCCAGTCTGG - Intergenic
1093682941 12:22023801-22023823 CTGTCCTCCAGATCCTAGTATGG + Intergenic
1095876011 12:47080216-47080238 CCTTCGTCCAGCTCCAAGCCGGG + Intronic
1095908620 12:47403371-47403393 CTCTTCTTCAGCTCAGAGTCTGG + Intergenic
1096689190 12:53309014-53309036 CTTTTCTCTGGCTCAGAGTCTGG - Exonic
1098850922 12:75594779-75594801 CTTTCCTCCACCTTCAAGTAGGG + Intergenic
1101375634 12:104168953-104168975 GTTTCCCCCAGCTCCAAGTTTGG - Intergenic
1104367864 12:128194116-128194138 CTTTCCTCCGACTCCGTGACTGG - Intergenic
1104643465 12:130481740-130481762 GTTTACTCCAGCTCTGAGCCTGG + Intronic
1105565384 13:21541306-21541328 CTTCCCTCCAGCTAGAAGTCTGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107942974 13:45391206-45391228 CGCTCGCCCAGCTCCGAGTCGGG + Intergenic
1108082466 13:46750861-46750883 TTTTCCTCCAGCTCCCTCTCTGG - Intronic
1108451807 13:50574775-50574797 CTTTCCTACATCTCAGGGTCAGG - Intronic
1113633879 13:111906853-111906875 CTTTCCTCAAGCTCAGTGTCTGG + Intergenic
1113910336 13:113838554-113838576 CCTTCCTCCTGCTCCGGGGCTGG - Intronic
1114969021 14:28002207-28002229 CTTTCCCCCAACTCCCTGTCAGG + Intergenic
1119002843 14:70898693-70898715 CTTTCCTCCAGCCCAGAAACAGG - Intergenic
1119538087 14:75419365-75419387 AATTCCTCCAGTTCCGAGTGTGG + Intergenic
1119916348 14:78405734-78405756 GTGTCCCCCAGCTCCAAGTCTGG - Intronic
1120691425 14:87597514-87597536 CTTTCCTAAGGCTCCCAGTCTGG + Intergenic
1122417973 14:101559507-101559529 CTCTTCTCCATCTCCCAGTCAGG - Intergenic
1122867393 14:104613414-104613436 CTTCCTGCCAGCTCCCAGTCAGG + Intergenic
1124593576 15:31075647-31075669 CTCTCCACCAGCTCCCAGTCAGG - Intronic
1124802183 15:32843777-32843799 CCTTACTCCATCTCAGAGTCAGG - Intronic
1125066182 15:35488059-35488081 CTTTGCTCCAGTTCCCAGTAAGG + Intronic
1125541080 15:40470678-40470700 CCTTCCTCCAGCAACGGGTCTGG - Intergenic
1125612430 15:40980516-40980538 TTCTCCTCCAGCTCAGACTCTGG - Intronic
1125727696 15:41876542-41876564 CTTCCCTCCAGCTCCAGGTGAGG - Exonic
1125854268 15:42934139-42934161 ATTGCCTCCAGCTCCGTCTCTGG + Intergenic
1128389594 15:67174130-67174152 CTCTCCTCCAGCCCCCACTCAGG + Intronic
1129920319 15:79314094-79314116 CATCCATCCAGCTCCCAGTCTGG + Intronic
1130349408 15:83078102-83078124 CTTTCCTGGAGCTCAAAGTCGGG - Intergenic
1130374647 15:83317950-83317972 CGTTCCTCCATCTCAGATTCAGG + Intergenic
1131058311 15:89389640-89389662 CTTCCCCCCAGCTCCAAGCCAGG + Intergenic
1132859958 16:2065540-2065562 CTTTCTTCCAGCTCCGGGGGTGG - Exonic
1135461033 16:22643126-22643148 CTTTCTTACAGTTCTGAGTCTGG + Intergenic
1135587052 16:23679392-23679414 CTTTCCAGCAGCTCCAGGTCTGG - Intronic
1135614959 16:23903156-23903178 CTTTACCACAGCTCTGAGTCAGG - Intronic
1135651968 16:24214161-24214183 CTGTCCTCCAGCTCTCAATCAGG - Intronic
1137677350 16:50310263-50310285 CATTCCTGCACCTCCCAGTCTGG - Intronic
1139295167 16:65894230-65894252 GTTTCCTTCAGCTCCAAGCCCGG + Intergenic
1140137152 16:72216988-72217010 CTTCATTCCAGCTCAGAGTCCGG - Intergenic
1140296894 16:73717651-73717673 CTCTCCTTCATCTCCGAGTTCGG + Intergenic
1142202461 16:88767794-88767816 CTGCCCTACAGCCCCGAGTCAGG + Intronic
1142642049 17:1289861-1289883 CCTTCCTCCAGCTGGGACTCAGG - Intronic
1144154071 17:12481397-12481419 AGTTCCTCCATCTCTGAGTCTGG + Intergenic
1144857934 17:18280584-18280606 CTGGCCTCCAGCACCGAGTCAGG + Exonic
1145935611 17:28713010-28713032 CTTTCCTCCAGACCCAAGTCCGG + Intergenic
1146833302 17:36089019-36089041 CCTCACTCCAGCTCCAAGTCAGG + Intronic
1147741135 17:42671520-42671542 TATTCCGCCAGTTCCGAGTCCGG + Exonic
1148482810 17:47971124-47971146 CTTTCCTCCACTTCCGCTTCAGG - Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1155972016 18:32092141-32092163 CTTTCCTCGAGCTTCCTGTCCGG - Exonic
1156634862 18:39015062-39015084 CTTTCCTCCACCTCCCAATATGG + Intergenic
1158199519 18:54924412-54924434 TTTTTTTCCAGCTCCAAGTCTGG - Intronic
1158821405 18:61163298-61163320 CTTTCATCCAGCTGCCAATCAGG + Intergenic
1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG + Intergenic
1160325749 18:77946460-77946482 CTTTCCTCCAGCAACTATTCTGG - Intergenic
1160588587 18:79927220-79927242 CCTGCCTGCAGCTCCGGGTCTGG - Intronic
1160631031 18:80246779-80246801 CTTGCCGCCGGCTCCGAGCCCGG - Intronic
1160755140 19:752999-753021 CCTTCCTGCAGCCCAGAGTCTGG - Intronic
1160764559 19:801648-801670 CTCCCCTCCAGCTCAGAGGCTGG - Intronic
1161053319 19:2176913-2176935 CTTTCCTCCTGCTCACTGTCAGG - Intronic
1161235119 19:3193849-3193871 CTTTCCTCCAGCCCCGTGAACGG + Intronic
1163036957 19:14575627-14575649 CTTTCATCCAGGTCACAGTCTGG + Intergenic
1164500385 19:28814791-28814813 ATTTCCTTCAGCTGCGAGCCTGG + Intergenic
1165648942 19:37469115-37469137 ATTCCCTGCAGCTCCGAGCCTGG - Exonic
1167526614 19:49988278-49988300 CTTCCCTCCTGCTCCCAGTTGGG + Intronic
1167728163 19:51233340-51233362 CTTTCCTCCAGCTGGAAGTACGG + Intronic
1202694528 1_KI270712v1_random:114620-114642 CTTTCCTCCTGCCCCGAGACTGG + Intergenic
925819284 2:7783675-7783697 CTCTCTTCCAGCTCCCAGTCTGG - Intergenic
926410181 2:12594869-12594891 CTTTCTTCCAGATCCGAGGAGGG - Intergenic
928265206 2:29805491-29805513 CCTTCCTCCTGCTCCCAGACAGG + Intronic
928401241 2:30980182-30980204 CTGCTCTCCAGCTCTGAGTCAGG - Intronic
931461988 2:62457371-62457393 CCTTCCTCCAGGTCCGCGACGGG - Intergenic
938177272 2:129144867-129144889 CTTTTCACCAGCTTAGAGTCAGG - Intergenic
945895281 2:215474300-215474322 CTTTCCTCCAGCTCCCTCTCTGG - Intergenic
946093595 2:217252292-217252314 TTTCCCTCCACCTCCGAGTGTGG + Intergenic
948785957 2:240353111-240353133 CTGGCCTCCAGCTCTGGGTCTGG + Intergenic
1169101183 20:2951171-2951193 CTTACTGCCAGCTCCGACTCCGG + Intronic
1169896361 20:10509069-10509091 CCCTCCTCCCACTCCGAGTCAGG + Intronic
1171411912 20:24953248-24953270 GTTTCCTCCATCTCCTTGTCTGG - Intronic
1171961549 20:31498338-31498360 CATTCCTCCAGCCCTCAGTCAGG + Intergenic
1172036084 20:32011646-32011668 GTTTCCTCCAGCACTGAGTATGG - Intronic
1172912243 20:38418601-38418623 CTTTTCTCCAGCTTAGCGTCTGG + Intergenic
1176861508 21:14013750-14013772 CTTGTCTGTAGCTCCGAGTCAGG + Intergenic
1177705165 21:24694789-24694811 CTTTGCTCCAGTTACAAGTCTGG - Intergenic
1178865032 21:36320202-36320224 CGTTCCGCCACCTCCCAGTCGGG + Exonic
1181094404 22:20495782-20495804 CCTCCCTCCAGCTGCGAGTGCGG - Exonic
1183466444 22:37982661-37982683 CTTTCCTCCCTCTCCCAGTTCGG - Intronic
1184536938 22:45093964-45093986 CTCCCCTCCAGCTCCCAGCCAGG + Intergenic
1185366655 22:50439950-50439972 CTTGTATGCAGCTCCGAGTCAGG + Exonic
949102657 3:164727-164749 CTTTCCTCCAGTTATCAGTCTGG - Intergenic
950381055 3:12615561-12615583 CTTTCCTCAAGCTGCGTGCCTGG + Intronic
951358911 3:21702019-21702041 CTGTCCTCCAGATCCGAGAATGG - Intronic
953110618 3:39934448-39934470 CTCTCCTCCAGCTCCCAGCCTGG - Intronic
956135035 3:66089878-66089900 CCTTGCTCCATCTCCGAGGCTGG - Intergenic
961220395 3:125194655-125194677 TTTTCCTCCAGCTCCCAGAAAGG - Intronic
968235966 3:197030085-197030107 CTGCCCTCCAGCCCCGACTCTGG - Intergenic
968872655 4:3249609-3249631 CTTTCTTGGAGCTCTGAGTCGGG + Intronic
969614112 4:8242383-8242405 CTTCCCTCCAGCCCCGCGGCGGG - Intergenic
972897128 4:43637391-43637413 CTTTCCTACAGCACCATGTCTGG - Intergenic
973803646 4:54502755-54502777 CTTGCCTCCATCTCCCTGTCTGG + Intergenic
975481208 4:74882317-74882339 GCTTCCTCCTGCTCCTAGTCTGG + Intergenic
981841859 4:149122282-149122304 CTTTCCCTCAGCTCAGAGCCAGG + Intergenic
984547061 4:181119004-181119026 CTTTCTTCCAGCTCCCTGTCTGG + Intergenic
985718734 5:1477367-1477389 CCTTCCCCCATCGCCGAGTCAGG - Intronic
988373007 5:30396535-30396557 CTTTCCTGCACCTCAGACTCTGG + Intergenic
1000024618 5:157347886-157347908 CTGGCCTCCGCCTCCGAGTCTGG - Intronic
1001963294 5:175893649-175893671 CTGGCATCCAGCTCAGAGTCAGG - Intergenic
1002711998 5:181200902-181200924 CTTTCCTTCAGCTTCCAGGCAGG + Intronic
1005370128 6:25123650-25123672 TTTTCCTCCAGCTCCATGTCTGG - Intergenic
1006385907 6:33730786-33730808 CTTTCCTCCATCCCCACGTCTGG - Intronic
1007378079 6:41469882-41469904 GTTTCCCCGAGCTCCGAGGCAGG - Intergenic
1011416194 6:87122535-87122557 CGCTCGCCCAGCTCCGAGTCAGG + Intergenic
1019409024 7:898627-898649 CTTTCCTCCAGGGCCCAGTCTGG - Exonic
1021558381 7:21944791-21944813 CTTTCCTCCACCTGCGTGCCTGG - Intronic
1024558006 7:50620329-50620351 CTTTCCTCAAGATTCCAGTCTGG - Intronic
1028226159 7:88255056-88255078 CCTGCCTCAAGCTGCGAGTCAGG - Intergenic
1029842166 7:103376587-103376609 CTTTCCTCCAACTCCAGTTCAGG + Intronic
1034063078 7:148110689-148110711 CATTCCTCCGGCTCTGAGCCCGG - Intronic
1044582759 8:93838479-93838501 CTTCCCTCCTGCTCCTACTCTGG - Intergenic
1045060878 8:98409836-98409858 CTTCCCTCCAGCACCCAGCCTGG - Intronic
1048857177 8:138695221-138695243 CTCCCCTCCAGCTCAGAGCCTGG + Intronic
1052021036 9:23525423-23525445 ATATCCTCCAGCACTGAGTCTGG + Intergenic
1052330361 9:27261178-27261200 CTGTCCTCCAGCACCTACTCAGG - Intergenic
1055305770 9:74927684-74927706 CTTCCCTCCAGTTACAAGTCCGG + Intergenic
1056655301 9:88503811-88503833 CTTGCCTCCAGCGCTGAGTGAGG - Intergenic
1056795370 9:89655346-89655368 TCTTCCTCCAGCTCCCTGTCTGG + Intergenic
1057345705 9:94248671-94248693 CTCTCCTTCAGCTCCTAATCAGG + Intergenic
1057471164 9:95357926-95357948 CCTTCCTCCAGCCCCGAGTAGGG - Intergenic
1058542984 9:106031078-106031100 CTTTGCTCCAGTTCCCATTCAGG - Intergenic
1059248614 9:112868326-112868348 CTTTCCACCCGCTCCAAGTCAGG + Intronic
1061524258 9:131145260-131145282 GTTTCCTCCAGATCTGGGTCGGG + Intronic
1061678118 9:132229658-132229680 CCTTCCTCCACCTCCATGTCTGG - Intronic
1061947450 9:133916648-133916670 CTTTCTTCCAGCTCAGCTTCTGG - Intronic
1062333938 9:136056701-136056723 CTCTCCTCCACCTCCCAGGCTGG - Intronic
1203778972 EBV:90232-90254 CATTCCTCCAGCTGCGAGCAAGG + Intergenic
1186804558 X:13126938-13126960 CTTATCTCTAGCTCCTAGTCTGG + Intergenic
1187895235 X:23974359-23974381 CTCTCCTCCACCTCCGAATGTGG + Intergenic
1187913958 X:24135636-24135658 CTCTCCTCCACCTCCGAATGTGG + Intergenic
1189617045 X:42794564-42794586 CCTTCCTCAAGCTCCATGTCTGG + Intergenic
1193180720 X:78453237-78453259 CTTTGAGCCAGCTCTGAGTCAGG + Intergenic
1197858624 X:130946446-130946468 CTCTCCTCCAGCTCTGTGTATGG + Intergenic
1199871290 X:151901125-151901147 CCTTGCTCCAGCTCCAACTCGGG - Intergenic