ID: 1079637982

View in Genome Browser
Species Human (GRCh38)
Location 11:22769208-22769230
Sequence GTGTTTTGTAAATATCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079637982_1079637987 25 Left 1079637982 11:22769208-22769230 CCAGGGTGATATTTACAAAACAC 0: 1
1: 0
2: 2
3: 38
4: 261
Right 1079637987 11:22769256-22769278 CAACCTATAGCCAACATGACAGG 0: 1
1: 0
2: 0
3: 8
4: 85
1079637982_1079637989 29 Left 1079637982 11:22769208-22769230 CCAGGGTGATATTTACAAAACAC 0: 1
1: 0
2: 2
3: 38
4: 261
Right 1079637989 11:22769260-22769282 CTATAGCCAACATGACAGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079637982 Original CRISPR GTGTTTTGTAAATATCACCC TGG (reversed) Intronic
901950300 1:12739954-12739976 GGCTTTTGTAAATATAATCCTGG - Intergenic
905071547 1:35230191-35230213 GTTTCCTGTAAAAATCACCCTGG + Intergenic
905802163 1:40851458-40851480 GTGTTTTGGAAAGGTCACTCTGG - Intergenic
907182092 1:52579595-52579617 GTGTTTTGAGAAAATCACTCTGG - Intergenic
907224338 1:52930430-52930452 GGGTTTTGCCAATATCGCCCAGG - Intronic
907840060 1:58148309-58148331 GTGTTCTGAAAATATCAATCTGG - Intronic
908406575 1:63819973-63819995 GTATTTTACAAATATCACCATGG + Intronic
909102651 1:71369180-71369202 TTGTTTTGTAATTATCACAAGGG + Intergenic
909126578 1:71679010-71679032 GTGTTTTGTAAAGATTGCTCTGG + Intronic
909170853 1:72293136-72293158 GTAGATTGAAAATATCACCCAGG - Intergenic
910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG + Intergenic
910345282 1:86229355-86229377 GAGATTTGTAAAAATCTCCCAGG - Intergenic
910819164 1:91327631-91327653 ATGTTTTGTAAATATCTATCAGG - Intronic
911715253 1:101125276-101125298 GAACTTTGGAAATATCACCCTGG - Intergenic
915993247 1:160538799-160538821 GTGTTTTGGAAAGATCACTCTGG + Intergenic
916824707 1:168432273-168432295 GTGTTTTGAAAAGACCACTCTGG + Intergenic
916888194 1:169090914-169090936 GTGTCCTGCAAATAGCACCCAGG - Intergenic
918368189 1:183831506-183831528 GTGTTTTTAAAAGATCACCATGG + Intronic
918753969 1:188312050-188312072 AAGATTTCTAAATATCACCCAGG - Intergenic
918820992 1:189253923-189253945 TTGTTTTTTAAAGATCACCCTGG - Intergenic
920016470 1:202914204-202914226 ATGTTTTGTAAAGATTATCCTGG + Intronic
920235308 1:204499289-204499311 TTGCTTTGGAAACATCACCCTGG - Intergenic
921009754 1:211129697-211129719 CTGTTTTATAAATATTACCATGG + Intronic
922370768 1:224908631-224908653 ATGTCTTTTAAATATCATCCTGG + Intronic
922375211 1:224957055-224957077 CTGTTTTGTAAAGATCACTCTGG + Intronic
922642823 1:227251788-227251810 GTGTTCTGTAAATATCAGTTAGG - Intronic
922815355 1:228445384-228445406 GCGTTTTGAAAATACCTCCCCGG + Intergenic
923112862 1:230906260-230906282 GTGATTTATAGAAATCACCCTGG + Exonic
923764101 1:236876566-236876588 GTGTTATGTAAATATGATGCTGG + Intronic
1062889192 10:1044762-1044784 GAGTTTTGTCAATTTCCCCCAGG + Intronic
1063903047 10:10755054-10755076 GTCTTTTGTAAACATAACCTTGG - Intergenic
1064042352 10:11978539-11978561 GAGTTTTTTAAAGATCACCCTGG - Intronic
1064272136 10:13875099-13875121 ATGTTCTGGAAATGTCACCCAGG + Intronic
1065196495 10:23270909-23270931 GAGTTCTGTACATATAACCCTGG - Intronic
1065981746 10:30904541-30904563 GTCTTTTGAAAACATCACTCTGG - Intronic
1069059463 10:63879818-63879840 ATGTTTGGTAAAATTCACCCAGG + Intergenic
1071426846 10:85565834-85565856 GTGTTCTGTAAATACCACTTAGG - Intergenic
1073887872 10:108062187-108062209 TTGATATGTAAATATCAGCCTGG - Intergenic
1074013655 10:109510106-109510128 GTTTGGTGTAAAGATCACCCAGG + Intergenic
1074830562 10:117245215-117245237 GTGTTTTGTAACTTTCACCTAGG - Intronic
1075988562 10:126811675-126811697 GTGTTCTGTAAATGTCACTTAGG - Intergenic
1076760787 10:132605029-132605051 GTGTTTTCTGAGAATCACCCTGG + Intronic
1079501955 11:21110827-21110849 CTGTTTTAAAAATATCACTCTGG - Intronic
1079535159 11:21505345-21505367 CTGTTTTGAAAAGATCACTCTGG - Intronic
1079637982 11:22769208-22769230 GTGTTTTGTAAATATCACCCTGG - Intronic
1080311737 11:30901905-30901927 ATGTTTGGTAAATATCAACCAGG + Intronic
1080374024 11:31686577-31686599 GTGTTTTAGAAGTATCACTCTGG + Intronic
1081049434 11:38318953-38318975 TTGTTTTGTAAATATCAATCAGG - Intergenic
1081733301 11:45386345-45386367 GAGTTTTGTTCTTATCACCCAGG + Intergenic
1083597463 11:63925154-63925176 GGGTTTTAGAAAGATCACCCTGG - Intergenic
1086688319 11:89758894-89758916 TTGATTTTTAAATAACACCCAGG + Intergenic
1086717541 11:90081051-90081073 TTGATTTTTAAATAACACCCAGG - Intergenic
1086820718 11:91433272-91433294 GAGTTCTGTCAATATAACCCTGG + Intergenic
1087044831 11:93836284-93836306 AAGTTTTGAAAATATCACTCAGG - Intronic
1087128379 11:94647983-94648005 TTATTTTTTAAATATCACACTGG + Intergenic
1087988431 11:104714874-104714896 GTGTTTTGTAGCTATCTACCAGG + Intergenic
1088364641 11:109027315-109027337 ATGTTTTGTAAATATCTCATAGG + Intergenic
1090316574 11:125795827-125795849 ATGTTTTGTAAATATCTACTAGG + Intergenic
1091537317 12:1423563-1423585 GTGTTCTGTAAGTATCAACTGGG + Intronic
1092822799 12:12368935-12368957 GTGTTCTATAAATATCACTTAGG + Intronic
1093541821 12:20296727-20296749 GTGTTCTGTAGATGTCACCTAGG + Intergenic
1093922564 12:24875681-24875703 GTGTATTTTAAATAACACCTCGG + Intronic
1094382293 12:29855954-29855976 GTCTTTTGGAAATACCACCCTGG - Intergenic
1094412332 12:30179687-30179709 GTGTTTTGGAAAGATCATTCTGG - Intergenic
1095857090 12:46872263-46872285 GTGTTTTGAAAAGTTCACTCTGG - Intergenic
1095859704 12:46903186-46903208 GTGTTTTGAAAAGATAAGCCTGG + Intergenic
1096592637 12:52671383-52671405 GTGTTTTGGAAAAGTCAGCCAGG - Intergenic
1096900078 12:54868150-54868172 GTGTTTTGTAATTCTCACTGTGG + Intergenic
1098218017 12:68240314-68240336 ATGTTTTGTAAAGATCACTCTGG - Intergenic
1098582676 12:72119526-72119548 ATGTTTTGTAAATATCTATCAGG + Intronic
1098657015 12:73044884-73044906 GTGTTTTGTAAATTTTGACCCGG - Intergenic
1098764818 12:74472826-74472848 GTGTTCTGTAATTATCAACTAGG - Intergenic
1100908692 12:99333045-99333067 GTGTTTTAGAAACATCACTCTGG + Intronic
1102888609 12:116540444-116540466 GTATTTTCTAAGTATCACCTTGG + Intergenic
1103131647 12:118474187-118474209 ATGTTTTGAAAATATCACTTTGG - Intergenic
1103672941 12:122633098-122633120 GTGTTTTATACAAATCACCTGGG + Intergenic
1104103652 12:125638923-125638945 GTGGCTTGTAAATGTCATCCTGG - Intronic
1108778090 13:53791543-53791565 ATGATATGTAAATATCATCCTGG - Intergenic
1108821009 13:54349702-54349724 GTATTTTTTAAAGATCTCCCAGG - Intergenic
1110875083 13:80499506-80499528 ATGGTTTATAATTATCACCCTGG - Intergenic
1111073521 13:83201449-83201471 TTGTGTTGTAAAAATCACCATGG - Intergenic
1113043375 13:106128042-106128064 GTGTTTTAGAAATGTCACTCAGG - Intergenic
1114596572 14:23917342-23917364 GTGTTTTGGTAAGACCACCCTGG + Intergenic
1116080037 14:40160219-40160241 ATGTTTTGTAAATATCTGCTAGG - Intergenic
1117876507 14:60256123-60256145 GTGTTTAGAAAATACCAGCCAGG + Intronic
1118334014 14:64836426-64836448 GTTATTTGTAAATAATACCCTGG - Intronic
1119965848 14:78914794-78914816 CAGTTTTGAAAAGATCACCCTGG + Intronic
1120187430 14:81408626-81408648 GTATTTTGTAATTATAACCTTGG - Intronic
1120459687 14:84779289-84779311 GTGCTTTGTAAATCACACCAGGG + Intergenic
1120858696 14:89235194-89235216 ATGTTTTGAAAACATCACCATGG + Intronic
1123475113 15:20585252-20585274 TTTTTTTGTAGATATCACCAAGG + Intergenic
1123476945 15:20597258-20597280 CTGGTTTGTACATATCACCCAGG + Intergenic
1123641066 15:22403106-22403128 CTGGTTTGTACATATCACCCAGG - Intergenic
1123642898 15:22415112-22415134 TTTTTTTGTAGATATCACCAAGG - Intergenic
1123668112 15:22625677-22625699 GTGTTTTGTTCTTGTCACCCAGG - Intergenic
1124524089 15:30432116-30432138 GTGTTTTGTTCTTGTCACCCAGG - Intergenic
1124534577 15:30534100-30534122 GTGTTTTGTTCTTGTCACCCAGG + Intergenic
1124764071 15:32473499-32473521 GTGTTTTGTTCTTGTCACCCAGG - Intergenic
1124774563 15:32575549-32575571 GTGTTTTGTTCTTGTCACCCAGG + Intergenic
1125765301 15:42131556-42131578 CTGTTCTGTATAAATCACCCAGG - Intergenic
1126188945 15:45859410-45859432 TTCTCTTGTAACTATCACCCAGG + Intergenic
1128478005 15:68013784-68013806 GTATTTTGGAAAGATCACTCTGG + Intergenic
1130760182 15:86811267-86811289 GAGTTTTTGAAATATCACTCTGG + Intronic
1131613077 15:93985533-93985555 GTGTTTTAGAAATATGACTCAGG + Intergenic
1131634864 15:94221543-94221565 CAGTTTTTTAAATATCAACCAGG - Intergenic
1131987006 15:98052676-98052698 GTGTTATGTAAGAATCACACAGG + Intergenic
1134386151 16:13774471-13774493 GTGTCTTGTAAATGTCAACTAGG - Intergenic
1138690619 16:58765331-58765353 GTGTTTTATAAATGTCAACTAGG + Intergenic
1139378649 16:66516503-66516525 GAGTATTGGAAATATCAGCCGGG + Intronic
1139412772 16:66778437-66778459 GAGTTTTGTACTTGTCACCCAGG + Intronic
1139516365 16:67454684-67454706 GTGTTTTAAAAAGATCACTCTGG - Intronic
1144155835 17:12500958-12500980 TTATTTCGTAAGTATCACCCTGG + Intergenic
1148040958 17:44707041-44707063 GTGTTTAAAAAATATCACCCTGG + Intergenic
1148664439 17:49363636-49363658 GTGTATTGAAAATGTCAGCCAGG - Intergenic
1148811977 17:50298906-50298928 GTGTTGTGTAAATATCCTTCTGG + Intergenic
1149095488 17:52835206-52835228 ATGTTTTGTAAATATCTTCCAGG - Intergenic
1149105939 17:52965110-52965132 GTGTTTTGTAAATATCTTGGGGG + Intergenic
1150166145 17:62945506-62945528 GTGTTTTAGACATATCATCCTGG - Intergenic
1150715690 17:67570881-67570903 GTTACTAGTAAATATCACCCTGG + Intronic
1153585294 18:6614658-6614680 GTGTTGTTTATAAATCACCCAGG - Intergenic
1153714673 18:7835567-7835589 ATGTTCTGTAAATATCTACCAGG + Intronic
1154087872 18:11324766-11324788 GTGTCTTGTCAAGATCAGCCAGG - Intergenic
1155414804 18:25586065-25586087 GTGTTTTGTAAATGTCAGTTAGG + Intergenic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1157298292 18:46461619-46461641 GAGTTTTGTTCTTATCACCCAGG - Exonic
1157829540 18:50844385-50844407 GTGATTTGTACATATAACCAAGG - Intergenic
1159373017 18:67553508-67553530 CTGTTGTGTAATTATCACCAGGG - Intergenic
1161129884 19:2581503-2581525 GTGTTTGGTAAACAACACCAGGG - Intronic
1165492150 19:36130137-36130159 GTGTTTTGAAAAAATTAGCCAGG - Intergenic
925229074 2:2215681-2215703 GTGTTTTGTAAACATCAGTTAGG - Intronic
925759872 2:7174268-7174290 ATGCTTTGTAAATATGACCCTGG - Intergenic
926358202 2:12060679-12060701 CTGTTTTATAAATATTACTCTGG + Intergenic
926574193 2:14562262-14562284 GTGTTTTTAAAATATCAATCTGG + Intergenic
927148611 2:20183039-20183061 GTGTTTTAGAAATGTCTCCCTGG + Intergenic
927225594 2:20762837-20762859 AAGTTTTGAAAATATTACCCTGG - Intronic
927238408 2:20899206-20899228 GAGTTTTGTTCCTATCACCCAGG + Intergenic
928083209 2:28327979-28328001 TTGTTTTGTAATTATGCCCCGGG - Intronic
928108312 2:28487226-28487248 GTGTTTTAGAAAGGTCACCCTGG + Intronic
928406658 2:31020164-31020186 GTGTTTTGCAGCTATCACACAGG + Intronic
928815421 2:35289482-35289504 ATGTTTTGTAAATATCTGCTAGG + Intergenic
929221720 2:39471530-39471552 CTGTTTTGTAAGAATCACCCTGG - Intergenic
930463895 2:51719888-51719910 CTGTTTTTTAAACATCAACCTGG + Intergenic
932977560 2:76622666-76622688 GTGTTCTGTAGATGTCTCCCAGG + Intergenic
933136966 2:78749820-78749842 GGTTTGTGTAAATATCACACTGG - Intergenic
933881489 2:86674221-86674243 CTGTTTTGTAAAGATAACACAGG + Intronic
935262720 2:101369142-101369164 GTGTTTTGAAAATATCCCTCTGG + Intronic
935591307 2:104847808-104847830 GTGTTTTGTACTTTTGACCCAGG + Intergenic
936478819 2:112866288-112866310 CTGTTTTGGAAATATCACCCTGG - Intergenic
937793729 2:125992041-125992063 GTGTTCTGTAAATATCTCTTAGG + Intergenic
937804128 2:126117734-126117756 GTGCTTTGTAAATATTAACATGG - Intergenic
939044124 2:137229843-137229865 GTGTTTTGCATATATCATTCAGG - Intronic
939289407 2:140174196-140174218 ATGTTTTGAAAATATCACTTTGG + Intergenic
941398552 2:165002564-165002586 GAGTTTTATAAATATCATGCTGG - Intergenic
941413340 2:165187650-165187672 GTGTTTTGAAACCATCACTCCGG - Intronic
942256720 2:174109883-174109905 TTTTTTTGTACCTATCACCCAGG + Intronic
943151656 2:184121647-184121669 GTATTTTGGAAAGATAACCCTGG + Intergenic
943482946 2:188444448-188444470 GTGTTTTCTCAATATTAACCTGG - Intronic
944989537 2:205220143-205220165 GTGTTTTAAAATGATCACCCAGG - Intronic
945410602 2:209501808-209501830 ATGCTTTGTAAATAACTCCCTGG - Intronic
946757302 2:222960513-222960535 ATGTTTTGGAAAGATCAGCCTGG - Intergenic
1169759134 20:9072578-9072600 TTGCTTTGAAAATATCACCCTGG + Intronic
1170080335 20:12468046-12468068 GTGTTCTGTAAATACTTCCCTGG - Intergenic
1170286394 20:14714417-14714439 ATGTTTTGTAAAGATCACTCTGG - Intronic
1170854624 20:20039659-20039681 GTGCTCTGTCAATATCACCAAGG + Exonic
1171483669 20:25471425-25471447 GTGTTTTTAAACTATCACTCTGG + Intronic
1173113748 20:40220606-40220628 GTTTTTGGAAAATATCAGCCTGG + Intergenic
1175278898 20:57789328-57789350 GTGTTTTGTAAGTAAGACCAGGG + Intergenic
1177811148 21:25926039-25926061 GTGTTTTGGCAATATTCCCCTGG - Intronic
1180033135 21:45225878-45225900 GTGTTTTGTGACAATCTCCCTGG + Exonic
1182723308 22:32422171-32422193 GTGTTTTATAAAGATCACTCTGG + Intronic
1182995616 22:34809289-34809311 CTATTTTAGAAATATCACCCCGG - Intergenic
1183593656 22:38796589-38796611 GTGTTGTGGAAAGATCACTCTGG + Intergenic
951144196 3:19206760-19206782 GTGTTTTGGATGAATCACCCAGG + Intronic
951729692 3:25796906-25796928 TTCTTTTGGAAACATCACCCTGG + Intergenic
951764841 3:26186183-26186205 CTATTTTGTAAATAACACCAAGG + Intergenic
952240797 3:31529992-31530014 GTGTTTTGAAAAGATTACCAAGG - Intergenic
952929685 3:38349398-38349420 TTGTTTTGAAAATATCTCTCTGG + Intronic
953796441 3:45989605-45989627 GTGTTTGGGAAAGATGACCCAGG - Intronic
956004751 3:64766492-64766514 GTTATATGTAAATATCACCAGGG - Intergenic
957206840 3:77209884-77209906 GAGATTTGTAAAAATCACCCAGG + Intronic
957746113 3:84345647-84345669 GTGTTTTGTAATTCTCATCGTGG - Intergenic
960186935 3:114654663-114654685 GTGTTCTGTAAACATCAAACAGG + Intronic
964309037 3:155372690-155372712 GTCTTTTGTAAATATCTCTTAGG - Intergenic
965378058 3:167951442-167951464 CTGTTTTATAAGTATCACCTTGG - Intergenic
965954049 3:174346729-174346751 GTGTTTTGTAAATAACAATCTGG + Intergenic
966409011 3:179629687-179629709 TTGTTTTTTAAAGATCACGCTGG + Intergenic
966519984 3:180863100-180863122 TTGTTTTGTAAATGTCAACTAGG - Intronic
966654505 3:182340066-182340088 GTGTTTTGTAATTCTCATCGTGG - Intergenic
967732581 3:192919447-192919469 GTGTTTTCTAAAGATCACTCTGG - Intergenic
970149267 4:13071686-13071708 GTGTCTTTTAAATATCTCCAAGG - Intergenic
971468549 4:26992795-26992817 GTGTTTACTAAGTATCACCAAGG + Intronic
972354800 4:38270179-38270201 GTATCTAGAAAATATCACCCAGG + Intergenic
976546215 4:86338428-86338450 GTGTTTTGGACAGATCACCCTGG + Intronic
977427093 4:96880750-96880772 GTGTGTTGTAAAAAGCACCAAGG - Intergenic
978839168 4:113189246-113189268 GAGTCTTCTAAATAACACCCTGG - Intronic
979147957 4:117269687-117269709 GTGTTTTATAAAGATCACTTTGG + Intergenic
979630439 4:122895703-122895725 GTGTTTTTTAAATATCAAGAGGG - Exonic
980647349 4:135659474-135659496 GTGTTTTGTAATTCTCACTGTGG + Intergenic
981549424 4:145928337-145928359 GTATTTTTTAAAAATCTCCCAGG + Intronic
983341862 4:166470408-166470430 GTGTTCTATAAATATCAACTAGG - Intergenic
983738168 4:171090056-171090078 CTGTTTTGTAAAAACCACCATGG - Intergenic
983905028 4:173172926-173172948 GTGTTTTGAAAAGATCACTCTGG + Intronic
984888109 4:184468858-184468880 GTGTGTTGTGAAAATCACCTGGG - Intronic
985221335 4:187708644-187708666 GGGTTTTACAAATGTCACCCAGG + Intergenic
989473208 5:41844977-41844999 GTCTTTTGTAACTATCACTGTGG - Intronic
990078912 5:51887773-51887795 GTGGTTTAGAAAGATCACCCTGG - Intergenic
990749662 5:59000643-59000665 GTGTTTTGTATATAGAACTCAGG + Intronic
991966975 5:72102404-72102426 TTGTTTTGTAGATTTCACCTTGG + Intergenic
992960008 5:81948761-81948783 GTGTTGTGGAAATTTCACCATGG - Intergenic
993127976 5:83858851-83858873 TTGTCTAGTAAATATCACTCAGG + Intergenic
994386172 5:99135461-99135483 GTGTTCTGTAAATATCAGTTAGG + Intergenic
995054574 5:107744998-107745020 GTGTTTTGAAAAGAGCACCCTGG + Intergenic
995591201 5:113701478-113701500 GTGTTTTAGAACTATCACTCAGG - Intergenic
996006094 5:118422190-118422212 GAGTTTTGTAAATATCTATCAGG - Intergenic
996210344 5:120800665-120800687 ATGTTTTGTAAATATCCCTAAGG - Intergenic
997275075 5:132578828-132578850 GTATTTTGAAAATATTACACTGG - Intronic
999699932 5:154218963-154218985 GTGTTTTGGAAAGATCACTCTGG - Intronic
999936824 5:156495584-156495606 GTGTATTTTTAATATCACTCAGG + Intronic
1001254173 5:170171039-170171061 GTGTTTTGGGAAAACCACCCTGG - Intergenic
1005427918 6:25723294-25723316 GAGTTTTGTTCTTATCACCCAGG - Intergenic
1005815251 6:29546651-29546673 GTATTTTTTAAATATTGCCCTGG - Intergenic
1007160285 6:39786137-39786159 GTATTTTGGAAATATTAGCCTGG + Intergenic
1008863755 6:56184574-56184596 GTGTTTTGTAAATATTAACTAGG - Intronic
1009482621 6:64178699-64178721 GTGCTTTTTAAATATCCTCCTGG - Intronic
1009914732 6:69979746-69979768 TTGTTTTTTAAATATATCCCTGG - Intronic
1010699682 6:79028289-79028311 GTGTTTTCTAAAGATCATCCTGG + Intronic
1011824270 6:91287923-91287945 TTGTTTTGTATGTATCACTCTGG + Intergenic
1013441398 6:110173956-110173978 GTCTTTTGTAAAGATCACTTTGG - Intronic
1015187505 6:130434975-130434997 GTGTTTTGTGAATTTCAAGCTGG + Intronic
1015376717 6:132518052-132518074 ATGTTTTCTAAAAATCACCAAGG + Intergenic
1015552752 6:134429461-134429483 GTGTTTTGTAAATATCATAAAGG - Intergenic
1016829522 6:148419831-148419853 CTGTTTTGTAATTAACACCCTGG + Intronic
1017241450 6:152174206-152174228 CTGTTTGGTAAACATCCCCCGGG - Intronic
1018591149 6:165423963-165423985 GTGTTTTGAAAAGATAACCCTGG - Intronic
1018685154 6:166298473-166298495 GTGTTTTTTAAACAACTCCCTGG + Intergenic
1019843664 7:3475065-3475087 GTGTTTTAAAATTATCATCCTGG - Intronic
1019884980 7:3896064-3896086 GTGTTCTGTAAATATCAATTAGG + Intronic
1020998355 7:15293568-15293590 GTTTTTTGTAACTAGTACCCTGG - Intronic
1021823167 7:24518307-24518329 GTGTTTTGGAAAGATCACTCTGG + Intergenic
1022526111 7:31038402-31038424 GCATTTTAAAAATATCACCCAGG - Intergenic
1022565813 7:31400249-31400271 GAGTATTGTAAATATCAGCTAGG + Intergenic
1022894294 7:34734023-34734045 GTGTTTTACAAATATTCCCCTGG + Intronic
1023046474 7:36214669-36214691 ATGTTTAGTGAACATCACCCGGG - Intronic
1024287883 7:47775288-47775310 GTGTTCTGTAAATGTCACCTTGG - Intronic
1024763908 7:52633439-52633461 AGGTTTTGTAAAGATCACACTGG - Intergenic
1027419552 7:78006057-78006079 GTTTCTTGTAAATAACACTCTGG - Intergenic
1027818460 7:83010729-83010751 GTGCTTTGGAAATATCACTAAGG - Intronic
1028899567 7:96081832-96081854 GTGTTTTTTAAAATTCAGCCAGG + Intronic
1030164909 7:106544341-106544363 GGGTTTTTTAAAGATCACTCTGG + Intergenic
1030585398 7:111412311-111412333 GTGTTCTGTAAATATCAAATAGG - Intronic
1030639444 7:111987650-111987672 GTGTGTTTTAAATGTCATCCTGG + Intronic
1032322620 7:130898522-130898544 GTGTTTTGTCTCTGTCACCCAGG + Intergenic
1032971557 7:137170084-137170106 GTGTTTAGTAAACATCATCAAGG - Intergenic
1033874375 7:145796081-145796103 TTGTTTTTTAAAAATCAGCCAGG - Intergenic
1034960770 7:155362972-155362994 TGGTTTTGTAAATATCAGTCTGG - Intronic
1035980234 8:4362213-4362235 GTCTTTTGTTAAAATCTCCCAGG - Intronic
1036600234 8:10254052-10254074 GTGGTTTGTAAATAACTCCCAGG - Intronic
1037365960 8:18122678-18122700 GTGTTTTGTTAAAGTGACCCTGG - Intergenic
1039273158 8:35905405-35905427 GTGATTTGAAAATATTCCCCAGG + Intergenic
1039700708 8:39958958-39958980 GTGTCTTTTCAATATCATCCTGG + Intronic
1040561024 8:48523617-48523639 GTGTTTTGTATCCATCACCAAGG - Intergenic
1042810279 8:72817927-72817949 GTGTTTTATAAATATCTTCATGG + Intronic
1043481635 8:80658583-80658605 GTGATTTGTAAACAACACCATGG - Intronic
1043566750 8:81557903-81557925 GAGTTTTGAAAGTAACACCCTGG + Intergenic
1044045978 8:87432727-87432749 GAGATTTGAAAATATCACCTGGG + Intronic
1045873745 8:106954727-106954749 GTGTTTTGTAACTGTAGCCCTGG + Intergenic
1046544666 8:115634645-115634667 GTATTTTCTGAATAGCACCCTGG - Intronic
1046565494 8:115894133-115894155 GTGTTTTGAAAAGCTCATCCTGG + Intergenic
1047304546 8:123642342-123642364 GTGTTTTAAAAAGATCACTCTGG + Intergenic
1047634723 8:126748478-126748500 GAGTGTTAGAAATATCACCCTGG + Intergenic
1047718408 8:127616859-127616881 GAGTTCTGTATATATCACCTAGG - Intergenic
1047914296 8:129565518-129565540 GTGTTTTGGAAAGATTACCCTGG + Intergenic
1048202784 8:132390554-132390576 GTGTTTTGTAAACATTCCCAAGG + Intronic
1050137382 9:2480694-2480716 GTGTTTTGAAAATATCACTCTGG - Intergenic
1050588148 9:7134625-7134647 GTGTTCTGTAAATATTATACTGG - Intergenic
1051756383 9:20405415-20405437 GTGTTTAGTCAATATCACAGTGG + Intronic
1051946385 9:22574106-22574128 GAGTTCTGTAGATATCAACCAGG - Intergenic
1052185189 9:25585349-25585371 GTGTTTTGTAATTCTCACTGTGG - Intergenic
1052257634 9:26477354-26477376 GTAATTTTTAAATATCACCCAGG - Intergenic
1052304904 9:26997184-26997206 GAGTTTTGTTATTATTACCCAGG - Intronic
1052396695 9:27947737-27947759 ATGTTATGTATGTATCACCCTGG + Intergenic
1054910817 9:70453647-70453669 GTGTTTTTGAAATATTATCCTGG + Intergenic
1058116851 9:101094119-101094141 GTCTTTTAGAAATATCACTCTGG - Intronic
1058799898 9:108535412-108535434 GTGTTTTATAAAGATCACTCTGG + Intergenic
1059135225 9:111799632-111799654 CTGTTTTAGAAATATCATCCTGG - Intergenic
1059149342 9:111935071-111935093 GTGTTTTGTAAATATAAACTAGG + Exonic
1059686357 9:116640778-116640800 TAGTTTTGAAAATATCACTCTGG + Intronic
1060317211 9:122523440-122523462 GTGTTTTCTAAAGATTACTCGGG + Intergenic
1061768444 9:132898383-132898405 GTGTTTTGTATATTTTACCACGG - Intronic
1186281031 X:7993425-7993447 GTGTCTGTTATATATCACCCTGG + Intergenic
1186368126 X:8917499-8917521 GTGATTTTAAAATATTACCCTGG + Intergenic
1186753266 X:12643436-12643458 ATATTTTAAAAATATCACCCTGG + Intronic
1186848837 X:13559005-13559027 GTGTTTTGCAAATGTGACACTGG - Intergenic
1190451361 X:50584493-50584515 GGGTTTTGGCAAGATCACCCTGG + Intergenic
1193052246 X:77114003-77114025 GTGTTCTGTAGATATCTCTCAGG - Intergenic
1193230522 X:79039946-79039968 GTGTTTTGTAATTCTCACTGTGG + Intergenic
1193484084 X:82064559-82064581 GTGTTTTGTAATTATCATTGTGG - Intergenic
1193528347 X:82621228-82621250 GAGTTCTGTAGATATCACTCAGG - Intergenic
1193572682 X:83162634-83162656 ATGTTTGGTAAATATTATCCAGG - Intergenic
1194699197 X:97093025-97093047 GAGTTTTTTAAAAATCAGCCAGG + Intronic
1195289874 X:103422037-103422059 GTGTTCTGTAAATATCAATTAGG + Intergenic
1198325637 X:135569651-135569673 GTGTTTTATAAAAATAACCATGG - Intronic