ID: 1079639034

View in Genome Browser
Species Human (GRCh38)
Location 11:22781147-22781169
Sequence CTGCTGTCCTTTGGCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079639032_1079639034 1 Left 1079639032 11:22781123-22781145 CCGGAAGTTGCAGAGTGGCAGAG 0: 1
1: 1
2: 2
3: 18
4: 251
Right 1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG 0: 1
1: 0
2: 0
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079639034 Original CRISPR CTGCTGTCCTTTGGCAAACA AGG Intronic
900110426 1:1003169-1003191 GAGCTGTCCTGTGGCAAAGAAGG - Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900652674 1:3737979-3738001 CAGCTTTTCTGTGGCAAACAGGG - Intergenic
901207697 1:7506225-7506247 CTGCTCTCCTTTGCCACACCTGG - Intronic
903175513 1:21577864-21577886 CCGCTGCCCTTTGGCCAACAGGG + Exonic
903315502 1:22501415-22501437 CTCCTTGCATTTGGCAAACAAGG - Intronic
903646393 1:24898653-24898675 CTGCTGTCTTTTGGGTAAAAGGG + Intergenic
904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG + Intronic
906120277 1:43385230-43385252 CTTCTGACCTCTGTCAAACAGGG - Intronic
906791463 1:48661776-48661798 CTACTGTCTTTTTACAAACAAGG + Intronic
909126087 1:71671747-71671769 CAACTGTACTTTGGCAATCATGG + Intronic
910018910 1:82561031-82561053 ATGTTGTTTTTTGGCAAACAAGG - Intergenic
911288573 1:96028156-96028178 CTGCTTGCCTTTGGCAGGCAGGG - Intergenic
917595273 1:176522891-176522913 CTTGTGGCCTTTGGCAAACGAGG + Intronic
917732256 1:177886482-177886504 CTGCTGTTCTGGGGCAAACTTGG - Intergenic
918400402 1:184156993-184157015 CACCTGTGCTTTGGCAACCAGGG - Intergenic
920314817 1:205069869-205069891 CTGCTGTCCTTCCGCAGGCAGGG + Exonic
1063006092 10:1971938-1971960 CTGCTTTCTTGTGGCATACATGG + Intergenic
1063512203 10:6656373-6656395 CAGCTGTACTTTGGCACACATGG - Intergenic
1066302333 10:34108127-34108149 CACCTGTCCTTTGGGAAAGATGG - Intergenic
1066605601 10:37166075-37166097 CTGCTTTCTTTCGGTAAACAGGG - Intronic
1066606315 10:37177137-37177159 CTGCTTTCTTTCGGTAAACAGGG - Intronic
1066607099 10:37188938-37188960 CTGCTTTCTTTCGGTAAACAGGG - Intronic
1067066793 10:43108568-43108590 CTGGTGTCCCTTGGCCAAGAGGG + Intronic
1067249270 10:44573716-44573738 GTGCTGTCTATTGGCAAGCAGGG + Intergenic
1068053982 10:51987354-51987376 CTGCAGTCATCTGGCAAAGAAGG + Intronic
1069815990 10:71194725-71194747 CAGCTGTCCTGTGGCAAGCTGGG + Intergenic
1071395783 10:85222539-85222561 CATCTGTCACTTGGCAAACATGG + Intergenic
1072780641 10:98248990-98249012 CTGTTTTCCTTTGGCCCACAGGG - Exonic
1075744330 10:124716093-124716115 CTGCTGTCCTTAGACAGAGAGGG + Intronic
1077887180 11:6394828-6394850 CTGCTGTCCTTTCACAGCCATGG + Exonic
1078650257 11:13184685-13184707 CTGCTCTCCTTTGGCAGCCGAGG - Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1080966871 11:37223979-37224001 CTGCTCCCCCTTGGCAAGCATGG - Intergenic
1085262385 11:75214479-75214501 CTGCTGTCCCTTGGCCAGGAGGG + Intergenic
1086445368 11:86865534-86865556 TGCCTGTCCTTTGGCAAAGAAGG - Intronic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1088514763 11:110619890-110619912 ATGCTTTACTTTGGAAAACAGGG - Intronic
1088768711 11:113011749-113011771 CTGCTTTGCTCTGCCAAACAAGG + Intronic
1090910009 11:131110677-131110699 CTGCTCGCCTTTGGCAGTCATGG - Intergenic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1093454234 12:19349165-19349187 CTGCTGTACTGGAGCAAACATGG + Intronic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1096994694 12:55831191-55831213 CAGCTGTCCTTTGGATATCAAGG - Intergenic
1098842318 12:75491279-75491301 CTGTTCTCATTTGCCAAACAGGG - Exonic
1101778866 12:107817739-107817761 CTGCTGAGATTTGGGAAACAAGG - Intergenic
1101788758 12:107909960-107909982 CTCCTGGCCTGGGGCAAACAAGG - Intergenic
1102368173 12:112357650-112357672 CTTCTTTGCTTTGGTAAACAAGG - Intronic
1108456294 13:50617326-50617348 CTGCTGCCTTTTAGCAAAGATGG - Intronic
1109982399 13:69925019-69925041 CTGCTTTCCCTTGGCAGGCATGG + Intronic
1111298299 13:86312746-86312768 CTCCTCTCTTTTGTCAAACAAGG - Intergenic
1113644650 13:111984941-111984963 ATGCTTTCATTTGTCAAACAAGG - Intergenic
1114667947 14:24391712-24391734 CTGGTGTCCTTGGGCAGCCAAGG + Intergenic
1115493611 14:33982063-33982085 CTGCTCCCATTTGGCAAATATGG + Intronic
1116257041 14:42570411-42570433 CTTCAGTCCTTTGGCAAATTTGG + Intergenic
1116591107 14:46774166-46774188 CAGATGACCTTTGTCAAACAGGG - Intergenic
1119641309 14:76317138-76317160 CTGCTCTCGTTTGGAAGACAGGG + Intronic
1122588355 14:102826807-102826829 CAGCTGTCCTTTGGCAGCCCTGG - Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1127739670 15:61890278-61890300 CTGCAGTGCTTTGGAAACCAAGG + Exonic
1129393144 15:75230608-75230630 CTGCTCTCCGCTGGCAAATATGG + Intergenic
1132423772 15:101696655-101696677 CTGGGGTCCTTTGGCCAAGAGGG - Intronic
1136995133 16:35183916-35183938 TTTCTGACCTTTGGCAAAAATGG + Intergenic
1140963395 16:79939996-79940018 CTCCTGTCATCTGGCAAACACGG - Intergenic
1141019634 16:80483101-80483123 CTGCTATCCTCTGAAAAACAAGG + Intergenic
1142240968 16:88944869-88944891 GTGTTCTCCTCTGGCAAACAAGG - Intronic
1144175645 17:12704153-12704175 TTGCAGTCCTCTGGAAAACACGG + Intronic
1144494579 17:15738186-15738208 CTGCAGTCCTATGGCAAGGATGG - Intronic
1144905680 17:18638492-18638514 CTGCAGTCCTATGGCAAGGATGG + Intronic
1145311755 17:21704684-21704706 CTGCAGTCCCTGGGCAAGCAGGG + Intergenic
1146619479 17:34386415-34386437 CTGCTGTCCTTTTTCCATCATGG + Intergenic
1146717797 17:35100927-35100949 GTGCTGTTGTTTGGGAAACAGGG - Exonic
1148212443 17:45816703-45816725 GCGCTGACCTTTGGAAAACAGGG - Intronic
1148223000 17:45877826-45877848 TTGCTGTCCCTTAGCAATCATGG + Intergenic
1148895844 17:50838643-50838665 TTGCTGACCTTTGCCACACAAGG + Intronic
1151276670 17:73039639-73039661 CTTCTGTCCTTTCACAAACATGG + Intronic
1151425283 17:74027121-74027143 CTGCTGTACATAGGTAAACATGG + Intergenic
1152196655 17:78922507-78922529 CTGCTGTCCTTAGAAGAACAGGG + Intronic
1152272776 17:79334746-79334768 CTGCTGTCATGTGGCAGACGAGG - Intronic
1152438852 17:80292855-80292877 TTGCTTTCCCTTGGCAACCAGGG + Intronic
1153073894 18:1140708-1140730 CTGCTGTCTTCTGGCATACATGG + Intergenic
1154380529 18:13845922-13845944 CTGCTGTCCACTGGCCAGCATGG - Intergenic
1156550414 18:38010240-38010262 CAGCTCTCCTATGGTAAACAAGG + Intergenic
1157602759 18:48904252-48904274 CTGCTTTCCCATGGCAGACAAGG + Intergenic
1158319094 18:56243882-56243904 CTGCTGTCTTTTTGCAGAAAAGG - Intergenic
1160345528 18:78128979-78129001 CTGCTGTCCTTTTAAAAAGAGGG + Intergenic
1161366595 19:3883459-3883481 CTGAAATCCTTTCGCAAACACGG + Intronic
1165419300 19:35715220-35715242 CTGCTCCCCTTTGGCCAACAGGG - Exonic
1167908698 19:52683863-52683885 CTGTTGTCCTGTGGCCAAGATGG + Intronic
1168020975 19:53608440-53608462 CAGCAGTCCTGTGGGAAACATGG + Intergenic
925045806 2:772393-772415 TTGCTGTCCTTTGGGAAATGGGG - Intergenic
926921503 2:17945039-17945061 CAGCTGTCCCTTGGCCATCATGG - Intronic
929906616 2:46051529-46051551 CTGCTCTCCTTTGGGGAACCTGG + Intronic
931774246 2:65526468-65526490 CTGTTGTCCTTTGGGAACAATGG + Intergenic
933514252 2:83280529-83280551 GTCCTGTCCTCTGGGAAACATGG - Intergenic
936943837 2:117913190-117913212 ATCCTGTCCTTGGGCCAACAGGG + Intergenic
939663108 2:144915055-144915077 CTTATGTCCTTTGGCACAAAAGG - Intergenic
942162553 2:173207010-173207032 CTGCTGTTCTTTTGCAATGAGGG + Intronic
943166252 2:184329892-184329914 CTGCTGTCTTTTTGCAATGAAGG + Intergenic
943757946 2:191577014-191577036 GTTCTGTCCTCTGGAAAACATGG + Intergenic
944214934 2:197245468-197245490 CTGCTGTCCCTTGGTATCCATGG - Intronic
944648660 2:201806571-201806593 CTGCTGACCTCTGGCAAAAAGGG + Exonic
945073888 2:206017746-206017768 CTGCTGTCCATCTGCAAACTTGG + Exonic
946341969 2:219075733-219075755 CTGCTTTCCTTTGCCAAACTTGG - Exonic
948217113 2:236240016-236240038 CTGCTGTCCTGTGGTACACCTGG - Intronic
1169126149 20:3128383-3128405 CTGCTTTCCTTTGGCATCCTAGG - Intronic
1170237837 20:14127411-14127433 CTGTTGTCTCTTGGCAAAAATGG + Intronic
1171187209 20:23131205-23131227 GTGTTGTCCATTGGAAAACATGG + Intergenic
1171218595 20:23372889-23372911 TTGCTGTCGTTTGGAAAAAATGG + Exonic
1174365504 20:50054019-50054041 CTCTTGTCCTTTTGAAAACAAGG + Intergenic
1176176673 20:63730296-63730318 CTACTGTTCTTAGGCACACAGGG - Intronic
1176790755 21:13316549-13316571 CTGCTTTCCTTAGGAAGACAAGG + Intergenic
1176800380 21:13422198-13422220 CTGCTTTATTTTGGTAAACAGGG + Intergenic
1177816813 21:25986789-25986811 CTGTTATCATTTGGCCAACATGG - Intronic
1178421821 21:32449382-32449404 CTCCTGACCTCTGGCAACCATGG + Intronic
1181064910 22:20300923-20300945 CTGCTGTGCTTGTGCACACAAGG + Intergenic
1181937803 22:26451130-26451152 CTGCCTTCCCTTGGGAAACATGG + Intronic
1182913882 22:34010205-34010227 CAGTTGTCCTTTGGTATACATGG - Intergenic
1183396455 22:37574118-37574140 CTGCTTTCCTATGGAAAATAAGG - Intronic
1184969508 22:48005156-48005178 CTCCTGTGCTTTGGCATGCATGG - Intergenic
952535349 3:34303630-34303652 CAACTTTTCTTTGGCAAACATGG - Intergenic
952598540 3:35049318-35049340 CTACTGTGTTTTGGCAAACACGG - Intergenic
952711757 3:36438894-36438916 ATGCTTTCCTTTGATAAACAGGG + Intronic
952965043 3:38615939-38615961 CTGCTGTCCTTAGCCACACCCGG - Intronic
954384637 3:50237660-50237682 CAGCTGGCCTTTTGCAAAGACGG + Intronic
956740842 3:72274691-72274713 CTGCTTTCATTTTGCAACCACGG - Intergenic
956867658 3:73385356-73385378 TTGCTTTACTTTGGAAAACATGG + Intronic
957049457 3:75400170-75400192 CTGCTGACCTCTGGCAACCGTGG - Intergenic
957740050 3:84253806-84253828 ATTTTGTCCTTTTGCAAACATGG - Intergenic
959110296 3:102115044-102115066 CTCCTCTCCTTTGGGACACATGG + Intronic
959270916 3:104208549-104208571 CTTCTGTCCTTTTGCTAAAATGG + Intergenic
961195498 3:124998162-124998184 CCGCAGTCCTTTGGAAGACACGG - Intronic
961881775 3:130066622-130066644 CTGCTGACCTCTGGCAACCATGG - Intergenic
963553793 3:146759761-146759783 ATGATGTCTTTTGCCAAACAAGG - Intergenic
967064494 3:185902898-185902920 ATGATGTGCTTTGGCAAATAAGG - Intergenic
969852066 4:9965483-9965505 CTGCCATCCTTAAGCAAACATGG + Intronic
972472175 4:39416850-39416872 CAGCAGTCCGTTGGCAAAGAAGG - Intronic
978225200 4:106324991-106325013 CTGCCGTCTCTTGGCAAAAATGG + Exonic
978506241 4:109460531-109460553 CTGCTGTCCTTTGCTACAAATGG - Intronic
982934149 4:161449589-161449611 CTGATGTCAATTGGCATACAGGG - Intronic
988077220 5:26368013-26368035 CTGTTGTCCTTTTGCCACCATGG + Intergenic
988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG + Intronic
989019232 5:36981670-36981692 CTGCTTTCTTTTGTCAAAGAGGG + Intronic
989276767 5:39598810-39598832 CTGCTGACCTGTGGAGAACATGG + Intergenic
993328586 5:86569775-86569797 CTGCTGGCCCTGGGCAAAGAGGG - Intergenic
996397699 5:123030029-123030051 TTGCTGTCCTTTGGAAAGCTGGG - Intronic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
999371482 5:151057963-151057985 CAGATGTCCCTTGGTAAACATGG - Intronic
999819393 5:155210423-155210445 CTGCGGTCCCTTGGCCAAGAGGG + Intergenic
1001155887 5:169272142-169272164 CTCCTGTCCTTTTACAAGCAAGG - Intronic
1002279334 5:178121470-178121492 CTGCTGTCTTCTGGCACACCTGG - Exonic
1002969442 6:1998825-1998847 CAGCTGTCCCTTGGCATCCATGG - Intronic
1003254308 6:4460812-4460834 CCGCTGGCCTTTTGCACACAGGG - Intergenic
1008253127 6:49265055-49265077 CAGCCTTTCTTTGGCAAACAGGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1011894116 6:92202454-92202476 CTGCTGTCATTTTGCCATCAAGG - Intergenic
1013181311 6:107719122-107719144 TTGCTCTCCTTTGGAAAATAGGG + Intronic
1013424088 6:109994829-109994851 AGCCTGACCTTTGGCAAACAGGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1015519335 6:134115091-134115113 CTGCTGTCACTGGGCCAACAGGG + Intergenic
1015971063 6:138742852-138742874 CTGCCATCCTCTGGCATACATGG - Intergenic
1022418056 7:30195241-30195263 CTGCTGTCCTTTACCTAACTGGG + Intergenic
1022596152 7:31714963-31714985 GTGCTGTCCTTTGGCATCTAAGG + Intergenic
1022952743 7:35354061-35354083 CTGCTTTCCTTTTGCAAATCAGG - Intergenic
1024345914 7:48313134-48313156 GTGCTGGGCTTTGGCAAGCAAGG - Exonic
1027288051 7:76671224-76671246 CAGCTGTGCATTGGCAAAGAAGG - Intergenic
1027444252 7:78254619-78254641 TTGCTGTCCGTTTCCAAACAAGG + Intronic
1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG + Intronic
1032272439 7:130422487-130422509 CTGCAGCCCTTTAGCCAACAGGG - Intronic
1033654887 7:143366449-143366471 CTTCTGGCCTTTAGCAAATAGGG - Intergenic
1034326381 7:150237635-150237657 CTGCTGTGCTTTGGAATCCACGG + Intergenic
1034766833 7:153731621-153731643 CTGCTGTGCTTTGGAATCCATGG - Intergenic
1035957551 8:4098744-4098766 CTGCTCTCCTTTGTCAGACAGGG + Intronic
1038083855 8:24172555-24172577 CTGCTGTCCTTTGAAAATCTTGG + Intergenic
1040759404 8:50820825-50820847 CTACTGTCTTTTGGAATACAGGG - Intergenic
1042293096 8:67190382-67190404 CTGCTGGCCCCGGGCAAACACGG - Intronic
1042760752 8:72269202-72269224 CTGATGTCCTTTCAGAAACATGG - Intergenic
1043516198 8:80996984-80997006 GTGCTGTCCTGTGACAATCATGG + Intronic
1044665833 8:94633544-94633566 CTGCTGGCCTTTTGCCATCAAGG - Intergenic
1045328078 8:101131721-101131743 TTGCTTTCCTTTGGAAAACAAGG - Intergenic
1045353261 8:101361737-101361759 CTGCTGTCTTTTATCAGACAGGG + Intergenic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1048386592 8:133918030-133918052 CTGGTTTCCATTGGGAAACAGGG - Intergenic
1048962230 8:139590120-139590142 CTGTTCTCCTTTGGCACACTGGG + Intergenic
1049981463 9:907922-907944 CTTCTGCCTTTTGGAAAACATGG + Intronic
1052914512 9:33914313-33914335 CTCCTGTATTTTAGCAAACATGG - Intronic
1055976376 9:81959176-81959198 CTGATGGCTTTTGGTAAACATGG + Intergenic
1057968040 9:99523582-99523604 CTTCTGGACTTTGGCATACATGG - Intergenic
1060144757 9:121242438-121242460 CTGCTGTCCTCTGGAAAAAGGGG + Intronic
1061361215 9:130143457-130143479 CAGCATTCCTTTGGCAAACTGGG - Intergenic
1061532082 9:131222393-131222415 CTGCTTTCTTCTGGAAAACAGGG - Intronic
1061774995 9:132956534-132956556 CTGCTGTACTTTGGCAGGGAAGG - Intronic
1061820773 9:133226203-133226225 CTGCTGTCCTTCTGCAGACAGGG - Intergenic
1062729062 9:138098323-138098345 CTCCTGCCCTTTGCCTAACAAGG - Intronic
1193787924 X:85783377-85783399 ATCATGTCCTTTGCCAAACATGG + Intergenic
1194409016 X:93534020-93534042 CAAATGTCCTTTGGCACACAAGG - Intergenic
1195234509 X:102883468-102883490 CTTCTGTCCTTTATCAAATAAGG + Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1195884768 X:109626332-109626354 CTGCTCTCATTTGGCAACTATGG - Intronic
1197552745 X:127914585-127914607 CTGCTTTGCTTTGGAAAACTAGG - Intergenic
1198920863 X:141724930-141724952 CTGATGTCCTTTGGGAGAAATGG - Intergenic
1199613318 X:149635507-149635529 TTGGTGACCTTTGGCAAGCATGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1200945620 Y:8833049-8833071 CTGATGTCCTTTGGAATAAATGG - Intergenic