ID: 1079641143

View in Genome Browser
Species Human (GRCh38)
Location 11:22806981-22807003
Sequence ATGGGTAAGTACATGAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079641140_1079641143 -4 Left 1079641140 11:22806962-22806984 CCTTTCTGTTTTAAGTATTATGG 0: 1
1: 0
2: 2
3: 53
4: 520
Right 1079641143 11:22806981-22807003 ATGGGTAAGTACATGAATCATGG 0: 1
1: 0
2: 1
3: 13
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079641143 Original CRISPR ATGGGTAAGTACATGAATCA TGG Intronic
902659115 1:17889209-17889231 AGGGGGAAGTAACTGAATCATGG - Intergenic
904222357 1:28982588-28982610 ATGGGCAAGTTCATGAAACCTGG - Intronic
904427186 1:30436296-30436318 ATGGGGAGGTAGTTGAATCATGG + Intergenic
905477406 1:38238807-38238829 ATGATTAAGTAAATGAATGACGG + Intergenic
905528351 1:38656386-38656408 GGGGGTGAGTACATGTATCAGGG + Intergenic
906760621 1:48373847-48373869 AGGGGGAAGTAATTGAATCATGG - Intronic
908034239 1:60034694-60034716 ATGAATAAGTATATAAATCAGGG - Intronic
909177832 1:72382304-72382326 AGGGGGAAGTAATTGAATCATGG + Intergenic
909204527 1:72738466-72738488 ATGGGGAGGTAGTTGAATCATGG - Intergenic
911738620 1:101363401-101363423 AGGGGTAGGTAGTTGAATCATGG + Intergenic
913004654 1:114617082-114617104 AGGGGGAAGTAATTGAATCATGG - Intronic
913489333 1:119364337-119364359 ATGGGGAGGTAATTGAATCATGG - Intergenic
915092192 1:153434394-153434416 ATGGGTAAGTACAGCAACCGAGG + Intergenic
917593025 1:176496886-176496908 ATGAGTGAGGACATGAATCCAGG + Intronic
917838588 1:178959687-178959709 AGGGGGAAATACCTGAATCATGG + Intergenic
918049059 1:180958775-180958797 AGGGGGAGGTAAATGAATCATGG - Intergenic
918295643 1:183153706-183153728 ATATGTAAGTAAATGAATAAGGG - Intergenic
920567450 1:206986162-206986184 ATGGGCAAATACATGCAACAGGG + Intergenic
920598217 1:207294492-207294514 ATGGGGAAGTATATTAGTCAAGG - Intergenic
920703088 1:208232358-208232380 ATGGGTAAGGAGAGGAGTCAAGG - Intronic
922900053 1:229129736-229129758 ATGGGGAATTACATGACTCCCGG + Intergenic
923125925 1:231034437-231034459 CTGGAGAAGCACATGAATCAAGG - Intronic
923235456 1:232028672-232028694 ATGGGTAAGTGCATGATTTTAGG + Intronic
923472119 1:234301010-234301032 CTGGGTAGAAACATGAATCATGG + Intronic
924806737 1:247367264-247367286 AAGGGGAAGTAATTGAATCACGG + Intergenic
1063910021 10:10819995-10820017 AGGGGGAGGTAAATGAATCATGG + Intergenic
1063945129 10:11168649-11168671 ACGGGTAAGGCAATGAATCAAGG - Intronic
1064896058 10:20238269-20238291 TTGGAGAAGTCCATGAATCATGG - Intronic
1066705364 10:38172018-38172040 ATGGGTAATTTCAAAAATCAGGG - Intergenic
1066985115 10:42458507-42458529 ATGGGTAATTTCAAAAATCAGGG + Intergenic
1067655187 10:48186438-48186460 AGGGGGAAGTAACTGAATCACGG + Intronic
1069225658 10:65941283-65941305 ATGGGTAAGAACATGGACCATGG - Intronic
1069652983 10:70064586-70064608 AGGGGGAAGTAACTGAATCATGG + Intronic
1071522184 10:86338243-86338265 ATGGATAAGCACATGAACCAGGG + Intronic
1072526692 10:96277757-96277779 AGGGGAAAGTAACTGAATCATGG + Intergenic
1073153576 10:101328656-101328678 ATGGGGAGGTAATTGAATCATGG + Intergenic
1074050978 10:109881131-109881153 AAGAGTAAGTACATCAAACAAGG + Intronic
1074287322 10:112110380-112110402 AAGGGGAAGTAATTGAATCATGG + Intergenic
1074564675 10:114566462-114566484 ATTGGTAAATACATGAAGAAGGG + Intronic
1075342480 10:121658535-121658557 ATGGGTAAGCTCATGTCTCAGGG - Intergenic
1078037001 11:7816657-7816679 ATGGGTAATTACAAGCCTCATGG + Intergenic
1078235333 11:9479395-9479417 CTGGTTAAGTACATGGTTCAGGG - Intronic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1079641143 11:22806981-22807003 ATGGGTAAGTACATGAATCATGG + Intronic
1079844195 11:25443877-25443899 ATTGGGAAGTAACTGAATCACGG + Intergenic
1082888648 11:58114602-58114624 ATGGGAAAGTATATCATTCAGGG - Intronic
1085752329 11:79172366-79172388 ATGGATAAGTGAATGAATAACGG - Intronic
1085756547 11:79206587-79206609 AGGGGGAAGTAAATGAATCCTGG + Intronic
1086078439 11:82878464-82878486 ATGGGGAGGTAATTGAATCATGG + Intronic
1087387194 11:97486603-97486625 ATGGGTACGTATACGGATCATGG + Intergenic
1089775263 11:120831447-120831469 ATGGAGAAGTCCATGAATTAGGG + Intronic
1092470791 12:8778537-8778559 ATGGCTAAGCACATTAACCAAGG + Intronic
1092486054 12:8902973-8902995 AAGGGGAAGTAATTGAATCACGG - Intergenic
1093264310 12:16983514-16983536 AGTGGTAAGTAATTGAATCATGG + Intergenic
1093789113 12:23226473-23226495 ATGTGTGAGTAAATGAATAAAGG - Intergenic
1094075661 12:26470921-26470943 AGGAGTGATTACATGAATCATGG + Intronic
1094195758 12:27748310-27748332 ATGAATAAGTAAATGAATAATGG + Intronic
1094374719 12:29777523-29777545 ATAGGTGAGTCCCTGAATCAAGG - Intronic
1095350747 12:41209149-41209171 GTGGCTAACTTCATGAATCACGG + Intronic
1097906369 12:64923629-64923651 ATGGGTATGTCTTTGAATCAAGG - Intergenic
1098628234 12:72699064-72699086 ATGGGGAGGTAACTGAATCATGG - Intergenic
1099405788 12:82260444-82260466 ATTGGTAGGTAATTGAATCATGG + Intronic
1099503818 12:83447335-83447357 ATGGGGAGGTAATTGAATCATGG + Intergenic
1099879130 12:88445316-88445338 ATAGGTCAATACATGATTCAGGG + Intergenic
1100074010 12:90755918-90755940 ATGGGAAGGTAGTTGAATCATGG + Intergenic
1102019653 12:109673310-109673332 ATGGTCAAGTCCATGAACCATGG + Intergenic
1103824020 12:123721617-123721639 ATGGGCAAGTTCATGAAACCTGG - Intronic
1104742625 12:131189569-131189591 AGGGGGAGGTACTTGAATCATGG - Intergenic
1105530108 13:21211406-21211428 AGGGGGAAGTAACTGAATCATGG + Intergenic
1107293379 13:38882747-38882769 ATGGGAATGAACATGAATTAGGG + Exonic
1107586286 13:41851490-41851512 AGGGGGAAGTAATTGAATCATGG + Intronic
1109076641 13:57845082-57845104 AGGGGGAAGTAATTGAATCATGG - Intergenic
1109076911 13:57847103-57847125 AGGGGGAAGTAATTGAATCATGG - Intergenic
1109240366 13:59879278-59879300 ATGGGAAACTACATGAATGCTGG - Exonic
1109622629 13:64929087-64929109 ATGTGCAAGTACAGAAATCAAGG + Intergenic
1111036044 13:82676470-82676492 ATTGGGAAATACTTGAATCATGG - Intergenic
1111498178 13:89081700-89081722 ATGGGGAGGTAATTGAATCATGG - Intergenic
1111555318 13:89873579-89873601 ATGGATAAGGAAATAAATCATGG + Intergenic
1111649701 13:91073731-91073753 ATGGGGAGGTAATTGAATCATGG - Intergenic
1111754177 13:92371751-92371773 AAGTGTAAGTAATTGAATCATGG - Intronic
1111972338 13:94929867-94929889 ATGGGGAGGTAATTGAATCATGG - Intergenic
1114806071 14:25838441-25838463 GTGGGTAAGTCCAAGACTCATGG - Intergenic
1118936372 14:70292538-70292560 CTAGGTAAGTACCTGAATTAGGG + Intergenic
1119216720 14:72875136-72875158 ATGGGGAGGTAATTGAATCATGG - Intronic
1120506654 14:85361232-85361254 AGGGGGAAGGATATGAATCAAGG + Intergenic
1121890283 14:97583792-97583814 ATGGGTGAGTGAATGAATGATGG + Intergenic
1123140745 14:106075407-106075429 AGGGGGAAGTAATTGAATCATGG - Intergenic
1127628626 15:60804554-60804576 ATGAGCAAGTTCGTGAATCAGGG + Intronic
1130029683 15:80300679-80300701 ATGGGTAAACTCATGACTCAGGG + Intergenic
1132041761 15:98530793-98530815 ATTGGTAAGTAGGTGAGTCAGGG - Intergenic
1132820507 16:1865623-1865645 ATGGTCAAGTACCTGATTCAAGG - Intronic
1133662925 16:7936448-7936470 ATGGTTAAGAACATGAGCCATGG - Intergenic
1134224741 16:12381437-12381459 ATGGGTGGGTAGATGAATGATGG - Intronic
1135895883 16:26402006-26402028 GTGGACAAGCACATGAATCAAGG - Intergenic
1136290844 16:29270540-29270562 ATGGGTGAGTGCATGGATCATGG + Intergenic
1137071078 16:35905305-35905327 ATGGGTAATTATATGCATGACGG + Intergenic
1138835729 16:60432263-60432285 ATGGGTAAGAATTTGAATCTAGG + Intergenic
1141266915 16:82505985-82506007 ATGGGTAAGTGAATGAATGGAGG + Intergenic
1143693444 17:8590702-8590724 CTGTGTAAGTAAATGAATAAAGG - Intronic
1144003382 17:11076314-11076336 ATGGCTAAATGCATGAACCAAGG - Intergenic
1145353241 17:22109270-22109292 ATGAGTAAATAGAAGAATCAAGG - Intergenic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1147788653 17:42998751-42998773 ATGGGCAAGTTCATGAAACCTGG + Exonic
1151440395 17:74125028-74125050 ATGGTCAAGTACATGGTTCACGG - Intergenic
1152128338 17:78460862-78460884 ATGAGTATGTACATGAATGAAGG - Intronic
1153538932 18:6134224-6134246 AGGGGGAAGTAATTGAATCATGG - Intronic
1156969115 18:43133634-43133656 AGGGGGAGGTACTTGAATCATGG + Intergenic
1158550816 18:58434308-58434330 AGGGGGAAGTAATTGAATCATGG + Intergenic
1158738387 18:60110474-60110496 GTAGGTAAGTACATGAATCTGGG + Intergenic
1158918664 18:62164800-62164822 GTGGGTAAAGAAATGAATCAAGG + Intronic
1159362069 18:67418370-67418392 ATGGGTCAGAGCATGAATCACGG - Intergenic
1159462245 18:68736767-68736789 ATGGGGAGGTAATTGAATCATGG - Intronic
1160310583 18:77786542-77786564 ATGGGGGATTACATGAATGATGG - Intergenic
1160601797 18:80019420-80019442 AGGGGGAGGTACTTGAATCATGG - Intronic
1162060009 19:8089205-8089227 ATTGGTAAGTGAATGAATAAGGG + Intronic
1164598000 19:29542714-29542736 ATGGGTAAGTAGGTAAAACATGG + Intronic
1164794852 19:31017603-31017625 AGTGGTAAGTAATTGAATCATGG - Intergenic
1166543066 19:43618423-43618445 ATGGGGGAGTACATGAGTTAAGG - Intronic
925654972 2:6136789-6136811 AGGGGGAAGTAACTGAATCATGG + Intergenic
925711368 2:6744151-6744173 ATGTGTAATTTCATTAATCAGGG - Intergenic
925845591 2:8030551-8030573 ATGGGTGAGCAAATGAATTAGGG - Intergenic
926465847 2:13186240-13186262 ATGGCTAAGTACATACATTAAGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930544391 2:52748101-52748123 ATGGTAAAGTGCAAGAATCATGG + Intergenic
930560249 2:52951298-52951320 GTGGGGAGGTAAATGAATCATGG - Intergenic
930924384 2:56798961-56798983 ATGGGTCACTACATTAAGCATGG + Intergenic
931145193 2:59508981-59509003 AGGGGGAAGTAATTGAATCATGG + Intergenic
931319924 2:61166171-61166193 CTGGGGAAGAACATGAGTCAAGG + Intergenic
931536256 2:63280401-63280423 ATGGGGAGGTAATTGAATCATGG - Intronic
931572573 2:63684306-63684328 ATGGGCAAGTTCATGAAACCTGG + Intronic
932690877 2:73912590-73912612 TTGTGTAAGGACCTGAATCATGG - Intronic
933387521 2:81630119-81630141 TTGAGTAAGGACATGGATCAAGG - Intergenic
936244521 2:110815233-110815255 ATTGGGAAGTAATTGAATCACGG - Intronic
936683595 2:114803061-114803083 ACGGGGAGGTACTTGAATCATGG + Intronic
937427513 2:121812378-121812400 AGGGGGAAGTAATTGAATCATGG + Intergenic
938660796 2:133485056-133485078 ATGGCCAAGTAAATGAATGATGG - Intronic
939626008 2:144478210-144478232 CTAGGTAATTACTTGAATCAAGG + Intronic
939987826 2:148849469-148849491 ATGGCTTAGAACATAAATCATGG - Intergenic
940068652 2:149658439-149658461 ATGGATAAGTGTATGAATAAGGG + Intergenic
940135100 2:150426640-150426662 CAGGGTAAGTACATTCATCATGG - Intergenic
940728564 2:157362744-157362766 AGGGGGAAGTAATTGAATCATGG + Intergenic
941560425 2:167036812-167036834 AGGGGTAGGTAATTGAATCATGG + Intronic
942387950 2:175461607-175461629 AGGGGGAAGTAATTGAATCATGG + Intergenic
944425411 2:199577146-199577168 AGGGCTCAGTACATGAATGAAGG - Intergenic
944922288 2:204428189-204428211 ATTGGTAAGTAACTGAATCATGG + Intergenic
945076046 2:206040432-206040454 ATGGGCAAGTGCATGAAACCTGG + Intronic
945646437 2:212501388-212501410 ATGAGTATTTACATGGATCAGGG - Intronic
1169648516 20:7841432-7841454 GTGGGTATGTACATGAGTAATGG + Intergenic
1169696991 20:8400755-8400777 ATGACTAAGTACATAAATTATGG - Intronic
1169726689 20:8741390-8741412 ATGAGTAAGTAGATGAATGATGG + Intronic
1172333799 20:34097052-34097074 ATGGCAAAGTACATGATACATGG + Intronic
1172987203 20:39001138-39001160 TTGGGGAAGTACATGATTGATGG + Intronic
1174142472 20:48425545-48425567 ATGGGTGAGTAAATGAGTGAAGG + Intergenic
1177485162 21:21746848-21746870 CAGGGTAAGTAATTGAATCATGG + Intergenic
1178751086 21:35303625-35303647 ATGGGGAGGTAATTGAATCATGG - Intronic
1179291294 21:40020426-40020448 AGGGGTAAAAACATGAAGCAGGG + Intronic
950766014 3:15273610-15273632 ACCGGTAAGTGCATGAATTATGG - Intronic
952005008 3:28833667-28833689 ATTGGTGAGTATATTAATCACGG + Intergenic
952200582 3:31123038-31123060 ATGAGTAAATACATGAATAAAGG - Intergenic
954998550 3:54904713-54904735 CTGGATAAATACATGATTCAAGG + Intronic
955621662 3:60870843-60870865 ATGGGTAAGACCATGGACCATGG + Intronic
955964675 3:64376630-64376652 ATGAGTAAGTATATGAAAAAAGG + Intronic
957527735 3:81398800-81398822 ATGTGTATATACATCAATCAAGG - Intergenic
957630384 3:82710422-82710444 ATGGGGAGGTAATTGAATCATGG - Intergenic
960072502 3:113446948-113446970 ATGGGGAGGTAACTGAATCATGG + Intronic
962158429 3:132973857-132973879 ATGGGTAAGTATAAGAAGCCAGG + Intergenic
962162542 3:133014132-133014154 AGGGGGAGGTAAATGAATCATGG + Intergenic
962373799 3:134842818-134842840 AGGGGTAAGGACATGCTTCATGG - Intronic
962654218 3:137526164-137526186 ATGGGAGAGTACAGGAATCTAGG + Intergenic
962672971 3:137727723-137727745 AGGGGAAAGTAATTGAATCATGG - Intergenic
963671955 3:148261981-148262003 ATAAGTAAGTACATGAATTTGGG + Intergenic
963716831 3:148812484-148812506 AGGGGTAGGTAATTGAATCATGG + Intronic
965499867 3:169444383-169444405 ATGGGGAGGTAATTGAATCATGG + Intronic
969929158 4:10613383-10613405 GTGGCTAAGTAGTTGAATCAAGG + Intronic
970322461 4:14888286-14888308 ATGGGGAGGTAATTGAATCATGG - Intergenic
970339292 4:15087348-15087370 ATGGGGAGGTAATTGAATCATGG - Intergenic
970427054 4:15955173-15955195 AGGGGGAAGTAATTGAATCATGG - Intergenic
970581642 4:17478815-17478837 AGGGGGAAGTAATTGAATCATGG - Intronic
971796898 4:31239633-31239655 ATGGGTAGGTGCATAAATAAAGG - Intergenic
972088953 4:35256376-35256398 AGGGGGAGGTACACGAATCATGG + Intergenic
973156655 4:46963378-46963400 AGGGGGAAGTAATTGAATCATGG + Intronic
973253269 4:48083220-48083242 ATGGGCAGGTGCAGGAATCAGGG - Intronic
974071156 4:57125484-57125506 ATAGGTCAGTTCATGAATTAAGG + Intergenic
976286297 4:83374688-83374710 ATGGGGAGGTAATTGAATCATGG - Intergenic
978682686 4:111401215-111401237 ATGGGGAAATAAATGATTCAGGG - Intergenic
978865928 4:113511430-113511452 ATGGGTACATACATTAATAAAGG + Intronic
979058710 4:116027607-116027629 ATGGGTCAGTTCATGAGTGACGG + Intergenic
979733276 4:124051483-124051505 ATATGTAAGTACATGAAAGAAGG + Intergenic
980311243 4:131132300-131132322 AAGGGTAAGTCCATGAGCCAGGG + Intergenic
980570612 4:134612136-134612158 ATGATTAAGTACATGAATCCAGG - Intergenic
981961282 4:150542233-150542255 ATGGGTAAGAGCATGAATTCTGG + Intronic
982828922 4:160035724-160035746 GTGGGCAGGTACATGAATCTGGG + Intergenic
985887378 5:2690018-2690040 GTGTGTAAATGCATGAATCAAGG + Intergenic
986617108 5:9629083-9629105 ATGGGTAAATCATTGAATCATGG + Exonic
987268928 5:16285086-16285108 ATGGGGAGGTAATTGAATCATGG - Intergenic
987794302 5:22607564-22607586 ATGGGGAGGTAATTGAATCATGG - Intronic
990093568 5:52084330-52084352 ATGGGGAGGTAATTGAATCATGG - Intergenic
990488525 5:56281808-56281830 AAGGGGAAGTAATTGAATCATGG - Intergenic
990704453 5:58512840-58512862 AGGGGTAGGTAATTGAATCATGG + Intergenic
992466282 5:77008622-77008644 ATGGGGAGGTAATTGAATCATGG + Intergenic
993741821 5:91550731-91550753 AGTGGTAAGTAATTGAATCATGG - Intergenic
994829621 5:104762432-104762454 ATTGTTAAGTAAATGAAGCAAGG - Intergenic
995369023 5:111397707-111397729 ATGAAAAAGTACATGAATCCAGG - Intronic
996008053 5:118447330-118447352 ATGAGTAAATACAAGAATGAGGG + Intergenic
996460324 5:123733458-123733480 AGGGGGAAGTAATTGAATCATGG + Intergenic
996857952 5:128030966-128030988 ATGGATTAATACATGAACCAAGG + Intergenic
997048666 5:130351553-130351575 ATGAGTAAGAACATGGAGCATGG - Intergenic
997726085 5:136120814-136120836 TTGGGTGGATACATGAATCATGG + Intergenic
998708973 5:144799321-144799343 ATGTGTAAGGGCAGGAATCAGGG - Intergenic
999575520 5:152972440-152972462 AGGGGGAAGTAATTGAATCATGG - Intergenic
999816641 5:155183736-155183758 AGGGGGAAGTAATTGAATCATGG + Intergenic
1000838002 5:166179779-166179801 CTTGGTAAGAACATGACTCAGGG - Intergenic
1001077561 5:168641853-168641875 AGGGGTAGGTAATTGAATCATGG + Intergenic
1003401898 6:5797482-5797504 AGGGGGAAGTAACTGAATCATGG - Intergenic
1007991561 6:46261342-46261364 ATGGGTAAGTACATTGTTCAAGG - Intronic
1008292473 6:49734128-49734150 ATGTGTAAATAAATGAATCCAGG - Intronic
1008297977 6:49801565-49801587 ATGGGGAGGTAATTGAATCATGG + Intergenic
1008345433 6:50421186-50421208 AGGGGGAAGTAATTGAATCATGG + Intergenic
1009824185 6:68845549-68845571 AGGGGGAAGTAATTGAATCATGG + Intronic
1010905677 6:81485068-81485090 ATGGGTAAATAAGTGACTCATGG + Intergenic
1011951096 6:92965548-92965570 ATCGGTAAGGATGTGAATCATGG - Intergenic
1012826503 6:104152750-104152772 AGGGGGAAGTAATTGAATCATGG - Intergenic
1013897462 6:115107043-115107065 AGGGGGAAGTAATTGAATCATGG - Intergenic
1015458350 6:133456967-133456989 ATGGGTAAGTTGAAGAAGCAAGG - Intronic
1015760183 6:136650196-136650218 ATGAGTAAGTTGATGAATGATGG + Intronic
1015993103 6:138969000-138969022 ACGGGTGTGTACTTGAATCAAGG - Intronic
1016336885 6:143015738-143015760 ATGGGGAAATACTTGAATAATGG + Intergenic
1017658914 6:156655244-156655266 ATGGCGAATTACATGAATCTAGG - Intergenic
1017694297 6:156999139-156999161 ATACGTAAGTACAGGACTCATGG - Intronic
1019282706 7:208379-208401 ATGGGTATGTACATGACTGTGGG + Intronic
1019566647 7:1684511-1684533 ATGGGTAAAGACATGAGACATGG - Intergenic
1019869730 7:3749098-3749120 ATAGATAAGTACATGAAAGAAGG + Intronic
1020081371 7:5287736-5287758 ATGGGTCAGTGCATGAGCCATGG + Intronic
1020631982 7:10650586-10650608 AGGGGTAGGTAATTGAATCATGG - Intergenic
1021984998 7:26089594-26089616 AGGGGGAAGTAACTGAATCATGG + Intergenic
1025197548 7:56944448-56944470 ATGGGTCAGTGCATGAGCCATGG - Intergenic
1025267107 7:57472090-57472112 ATAGGAAAGTTCATGAATAATGG - Exonic
1025274230 7:57560829-57560851 ATGAGTAAATAGAAGAATCAAGG + Intergenic
1025674399 7:63632491-63632513 ATGGGTCAGTGCATGAGCCATGG + Intergenic
1025748467 7:64269026-64269048 ATAGGAAAGTTCATGAATAATGG - Intergenic
1028011075 7:85645204-85645226 AGGGGGAAGTAATTGAATCATGG + Intergenic
1028312125 7:89352160-89352182 ATTGGTAATTACATGTATAAAGG + Intergenic
1028486240 7:91360617-91360639 ATGGGTGAATAAATGAATCCTGG - Intergenic
1028745176 7:94319669-94319691 AGGGGGAAGTAATTGAATCATGG - Intergenic
1030254611 7:107494863-107494885 ATGGCTGAGAACAGGAATCAGGG + Intronic
1030307071 7:108029757-108029779 AAGGTTAAGTAGATGAATAAAGG + Intronic
1031702843 7:124945996-124946018 ATGGATAGGAACATGGATCATGG + Intergenic
1032359550 7:131242592-131242614 ATGGGCAAGTTCATGAAACCTGG + Intronic
1033835013 7:145300001-145300023 ATGGGGAAGTAATTGAATCATGG - Intergenic
1033926478 7:146468225-146468247 GTAGGTAAGAACATGCATCATGG + Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1038595692 8:28883806-28883828 TTGAGTAAATACATGAATGATGG + Intronic
1039088991 8:33808423-33808445 CTGGGAAAGTACAAGAAGCATGG + Intergenic
1039240175 8:35547781-35547803 ATGGGTGAGTGCATTAGTCAGGG + Intronic
1039676178 8:39670380-39670402 AAAGCTAAGTAAATGAATCAAGG - Intronic
1042309248 8:67363884-67363906 ATGGGTAATTACATGATTCAGGG + Intergenic
1042466227 8:69132637-69132659 AGGGGTACGTAATTGAATCATGG - Intergenic
1043682573 8:83047918-83047940 AAGGTAAAGTACATGCATCATGG + Intergenic
1044066760 8:87707800-87707822 AGGGGGAGGTAAATGAATCATGG - Intergenic
1044953460 8:97455802-97455824 ATGGATAAATAGATGAATAAAGG - Intergenic
1046633396 8:116644529-116644551 CTGGGCAAGTACATGAAGCCTGG + Exonic
1048074675 8:131056437-131056459 ATGGTTCAGTAAATGCATCAAGG - Intergenic
1051771273 9:20582791-20582813 AGGGGGAAGTAATTGAATCATGG - Intronic
1052071090 9:24081884-24081906 AGTGGGAAGTAGATGAATCATGG + Intergenic
1055604685 9:77956518-77956540 ATGGGAAGGAACATGAATCCTGG + Intronic
1055764090 9:79642683-79642705 ATGGGAAAGTTAATAAATCAGGG + Intronic
1055792886 9:79942609-79942631 ATGGGTATGTCCATGGCTCAGGG + Intergenic
1058086847 9:100756812-100756834 AGGGGGAAGTAATTGAATCATGG + Intergenic
1061341400 9:129984712-129984734 AGGGGGAAGTAATTGAATCATGG + Intronic
1061998668 9:134204656-134204678 ATGCGTAAGTACAGAAATCTAGG - Intergenic
1185883876 X:3764536-3764558 ATGGATAGATAAATGAATCATGG - Intergenic
1185893500 X:3839701-3839723 CAGGGGAAGTACCTGAATCATGG + Intronic
1185898617 X:3878125-3878147 CAGGGGAAGTACCTGAATCATGG + Intergenic
1185903732 X:3916554-3916576 CAGGGGAAGTACCTGAATCATGG + Intergenic
1186449201 X:9657972-9657994 AGTGGGAAGTAAATGAATCATGG + Intronic
1186485274 X:9929824-9929846 AGGGGGAAGTAATTGAATCATGG + Intronic
1186804486 X:13126419-13126441 ATGGGAAAGCACATGATTCCTGG - Intergenic
1188588086 X:31801346-31801368 AGGGGGAAGTAATTGAATCATGG - Intronic
1188949979 X:36359195-36359217 ATGGCTAAATTCATGAATAAGGG - Intronic
1189122137 X:38406270-38406292 ATGGGGAAATAGATTAATCATGG - Intronic
1190089111 X:47422023-47422045 ATGGCTAAGAACATGAATGCTGG + Intergenic
1190122713 X:47675532-47675554 ATGGTTAAGAACATGAATGCTGG - Intergenic
1190218910 X:48498393-48498415 GTGGGTAAGTGGGTGAATCATGG - Intergenic
1191089354 X:56603429-56603451 AGGGGGAAGTAATTGAATCATGG - Intergenic
1191139186 X:57097524-57097546 CTGGGTAAGTAAATAAATGAAGG + Intergenic
1191158057 X:57296721-57296743 ATGGCTAACTACAATAATCAAGG + Intronic
1191160749 X:57327713-57327735 ATGGCTAACTACAATAATCAAGG - Intronic
1193187574 X:78531037-78531059 ATGTGTAGGTTCAGGAATCAAGG + Intergenic
1193671247 X:84389388-84389410 ATGGGTGAGTCCCTGAGTCAGGG - Intronic
1195032306 X:100937964-100937986 ATGGGAAAGATCATGAATCTTGG + Intergenic
1197426504 X:126303963-126303985 ATTGGTAGGTAATTGAATCATGG + Intergenic
1197464410 X:126784971-126784993 GTGGGGAGGTACTTGAATCATGG + Intergenic
1197547207 X:127839487-127839509 AGGGGTAAGTAATTGAATCATGG - Intergenic
1198136806 X:133760633-133760655 ATGGGAAAGTAAGTGAAGCATGG + Intronic
1199795285 X:151190045-151190067 ATGGATAAGTGAATGAATGACGG + Intergenic
1200781544 Y:7220755-7220777 ATGGATAGATAAATGAATCATGG + Intergenic