ID: 1079642822

View in Genome Browser
Species Human (GRCh38)
Location 11:22828618-22828640
Sequence GTGTGGTTATCAAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079642817_1079642822 -9 Left 1079642817 11:22828604-22828626 CCAAGCAGTGAGCCGTGTGGTTA 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 22
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079642822 Original CRISPR GTGTGGTTATCAAGGGAAGA GGG Intronic
901521090 1:9785665-9785687 CAGTGGTTCTCAAGGGAGGAGGG - Intronic
902191804 1:14768850-14768872 GTTTGCTTTTCAAGGGAAGCCGG + Intronic
904161651 1:28526471-28526493 GTGTATTTATCCAGGCAAGACGG + Intronic
904656885 1:32055483-32055505 ATGTGGGTCTCAAGAGAAGAGGG - Intronic
905328721 1:37176799-37176821 GTATGGAAACCAAGGGAAGAAGG + Intergenic
905425596 1:37881421-37881443 GTGTGGTGCTCCAGGGAAGAGGG - Intronic
905546779 1:38806457-38806479 GTGTGGTTGTCAGGGGCTGAGGG + Intergenic
906140914 1:43532839-43532861 GTGTGGAAATGAAGGCAAGAGGG - Intronic
906381766 1:45337006-45337028 GTTTGGCTATGAAGGGAAGGAGG - Intronic
908673987 1:66580372-66580394 ATGTAGTTATCAGGGGAAGAGGG - Intronic
908856282 1:68433350-68433372 GAGTGGTGATCTAGGAAAGATGG + Intronic
912200481 1:107452341-107452363 GTGTGTCTATCAAGGAAACATGG + Intronic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
915834673 1:159166745-159166767 GTTTGGTTCTGAAGGAAAGATGG - Intergenic
921118156 1:212113952-212113974 GAGGGGTTAACAAGGGAAGCAGG + Intergenic
923016180 1:230128273-230128295 GTGTGGTTATGAAGGAAAACAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924407487 1:243765611-243765633 GTTTGGTTAACAAGGGAATCAGG - Intronic
924836434 1:247652497-247652519 TTGTGGTTCTCCAGAGAAGATGG - Intergenic
1069545116 10:69322114-69322136 GTTTGTTTAGAAAGGGAAGATGG + Intronic
1069622142 10:69844240-69844262 GTGTGGCTGTCCAGGGAGGATGG + Intronic
1070496354 10:77027579-77027601 GAGTGTTTCTCCAGGGAAGAGGG - Intronic
1073932364 10:108590500-108590522 GTTCGGTTCTCATGGGAAGAAGG + Intergenic
1075049678 10:119173745-119173767 GTGTATTTATCCAGGCAAGATGG + Exonic
1075930310 10:126289510-126289532 GTGTGCTCACCATGGGAAGAAGG + Intronic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1079137654 11:17785025-17785047 GTGGGGGTGTCAAGGGATGATGG + Intergenic
1079515943 11:21268739-21268761 GTCTGGTTATCAAGAAAAAATGG + Intronic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1079793743 11:24772303-24772325 GTGTGTTTATTGAGGCAAGAAGG - Intronic
1080599992 11:33812305-33812327 GTGAGTTTATCACTGGAAGACGG + Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1086080070 11:82894805-82894827 CTATTGTTATCAAGAGAAGAAGG + Intronic
1086686550 11:89740315-89740337 GTGTGTTTAGCAAAGGAAGTTGG - Intergenic
1087700801 11:101434247-101434269 GTGTGGTTAAGAAGGGATAAGGG + Intergenic
1088041430 11:105388699-105388721 GTTTGGTAATCAAGAGAATATGG + Intergenic
1090541514 11:127711559-127711581 GGGTGGTTAGCAAGGGAGGGAGG - Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091131271 11:133149036-133149058 GTGTGGTGTTCAAGGAAGGAGGG - Intronic
1093509492 12:19909591-19909613 TGGTGGTTATCAAGGGCTGAGGG - Intergenic
1097309064 12:58098881-58098903 GAGTGTTTATAAAGGGAAGCAGG - Intergenic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1099376720 12:81902013-81902035 GGGTGGTTAACAACAGAAGAGGG + Intergenic
1101576737 12:106004334-106004356 GTGGGATTATCAAGGGAATGGGG + Intergenic
1103272000 12:119681192-119681214 GTGTGATTTTATAGGGAAGAGGG - Exonic
1104476579 12:129075341-129075363 GTGTTGTTATAAAAGGAAGATGG + Intronic
1106456370 13:29930752-29930774 GGGAGGATATAAAGGGAAGAGGG + Intergenic
1107403314 13:40090352-40090374 GTAGTGTTAGCAAGGGAAGAGGG - Intergenic
1107602273 13:42025503-42025525 GTTTGTTTTTCAAGGGAAAATGG + Intergenic
1107765787 13:43733109-43733131 GTCTGGTTATCCAGGTATGAAGG - Intronic
1109490021 13:63085487-63085509 GTGTTGGTAGCAAGGGAAAATGG + Intergenic
1109928422 13:69179950-69179972 TTGTCTTTATTAAGGGAAGATGG - Intergenic
1110050726 13:70895094-70895116 TTGAGGATATCATGGGAAGATGG + Intergenic
1110293902 13:73840275-73840297 GTGAGGTTAGAAAGTGAAGAGGG - Intronic
1111713697 13:91850433-91850455 GTGGGTTTATTAAGGGCAGAGGG - Intronic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1116003590 14:39269350-39269372 TAGTGGTTGTCAAGGGATGAGGG - Intronic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118054370 14:62063854-62063876 GTGTGTTAATAAAGGGATGAAGG + Intronic
1118748212 14:68789358-68789380 GTGGGGTTATGAGGGGGAGAGGG + Exonic
1119279445 14:73392127-73392149 TTCAGGTAATCAAGGGAAGATGG - Intronic
1120665965 14:87307163-87307185 GAGTGGTTTTCAGGGGCAGAAGG + Intergenic
1121077948 14:91084889-91084911 TTGTGTTTATCAAGGGAGGGTGG + Intronic
1122202385 14:100130491-100130513 GTGGGGTTACCAAGGGAGCAGGG - Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1124439294 15:29675081-29675103 GTGGGGTGAGCAAGGGAGGAGGG - Intergenic
1125191736 15:37001527-37001549 GTGTGGTGAACAGGGAAAGAGGG - Intronic
1126185491 15:45827439-45827461 GGGTGGTTATCAAGGCTAGGTGG + Intergenic
1129233248 15:74208482-74208504 CTGTGGTCAGCAAGGGAACAAGG - Intronic
1129331482 15:74830115-74830137 GTCTCGTTCTGAAGGGAAGAGGG - Exonic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1135131816 16:19859695-19859717 GCGAGATGATCAAGGGAAGAAGG + Exonic
1139354488 16:66359503-66359525 GTCAGGTTCTCCAGGGAAGAGGG - Intergenic
1140298179 16:73728995-73729017 GTGTGTTCAGCCAGGGAAGAAGG + Intergenic
1141278483 16:82608882-82608904 CTGTGGTTGTCAGGGGATGAAGG + Intergenic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1141825066 16:86472973-86472995 GTGTGTTGGCCAAGGGAAGACGG + Intergenic
1145760877 17:27425086-27425108 TTGTGGGTACCAAGGGAAGCTGG - Intergenic
1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG + Intronic
1146564498 17:33900748-33900770 GGGAGGGTATCTAGGGAAGAGGG + Intronic
1148996349 17:51713654-51713676 GTGCTGTTACCAAGGGAAGAGGG - Intronic
1149903589 17:60504964-60504986 GGGTTGTTATCAAGGAAAAATGG + Intronic
1150915092 17:69428768-69428790 GTGTGGTTCTCAGGAGAATAAGG + Intronic
1151082341 17:71343329-71343351 GTTTGAGAATCAAGGGAAGAAGG + Intergenic
1151208533 17:72526463-72526485 TTGTGGTTACCTAGGGGAGAAGG + Intergenic
1151347853 17:73514321-73514343 GTGCGAATATCAAGGGAAGATGG - Intronic
1153540077 18:6144597-6144619 GTTTGGTTGGCAAGGAAAGAGGG - Intronic
1155279099 18:24219953-24219975 GAGTGGTTATCCAGCGAATAGGG - Intronic
1155475647 18:26234068-26234090 GGGTGGTTAACAACAGAAGAGGG - Intronic
1156159484 18:34342606-34342628 GTGTGGACAGCAAGAGAAGAAGG - Intergenic
1156578532 18:38348685-38348707 GGGTAGTTATCAAGAGAAGGGGG + Intergenic
1156599956 18:38594206-38594228 GTGTCGTTATCTAGAGAAGATGG + Intergenic
1156610897 18:38722914-38722936 ATGAGGTTATCAATGGAAGGGGG + Intergenic
1164749056 19:30637645-30637667 ATGTGATCATCAAGGGTAGAAGG - Intronic
1165371695 19:35411639-35411661 GTGTGGTATTAAAGGGAAGAAGG - Intergenic
926670235 2:15570210-15570232 GTGTGGGAATCCATGGAAGACGG - Intergenic
927455641 2:23247002-23247024 GTCTGATTATCAAGGGAGGTGGG - Intergenic
931984950 2:67732703-67732725 TTGAGGATATCAAGGCAAGAAGG - Intergenic
932186385 2:69699795-69699817 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
933343636 2:81054134-81054156 GTGTGGTAATCAAGTGAACTGGG - Intergenic
934765184 2:96876540-96876562 GTGTGCTTGTCACGAGAAGAAGG - Intronic
934784463 2:96995045-96995067 GTGTGGTTCTACAGGAAAGAGGG + Intronic
935321460 2:101893532-101893554 GTGTACATATCAAGAGAAGAAGG + Intronic
939852317 2:147316956-147316978 GGGTGGTTAACAACGGAAGAAGG + Intergenic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
947031821 2:225805025-225805047 GTGTTGTTATAAAGGGAATTGGG + Intergenic
947115991 2:226771196-226771218 CTGTGTTTATCAAGGTCAGAAGG + Intronic
1169831887 20:9834575-9834597 GTGTGCTTATCTGGGGAAAAAGG - Intronic
1170682040 20:18534868-18534890 ATGGGGTTAGCAAGGCAAGAAGG + Intronic
1170857393 20:20069674-20069696 GGTTGGTTATCAATGGAAGGTGG + Intronic
1174085406 20:48004542-48004564 GTGAGGATGACAAGGGAAGAAGG + Intergenic
1175596058 20:60233901-60233923 GTTTGGTGATCAAGGAAAGGTGG - Intergenic
1176012171 20:62903846-62903868 GTGTGGCAAAGAAGGGAAGAGGG + Intronic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1180594580 22:16964857-16964879 GTGTGGCTGTCATGGGAAGAAGG + Exonic
1181078498 22:20397549-20397571 TAGTGGTTACCAAGGGGAGAGGG - Intronic
1181459426 22:23077594-23077616 GTGGGGTCAGCAAGGGAGGAGGG + Intronic
1182147539 22:28005897-28005919 GTGTGGTTCTCTAGGGCTGAGGG - Intronic
1182206783 22:28635964-28635986 GGGTGGTTATCAGGGGACAAGGG - Intronic
1183506277 22:38210744-38210766 TTGTGGATATCTAGGGAACAAGG + Intronic
1185039201 22:48495814-48495836 GTGTGGTGAGCCAGGGGAGAGGG - Intronic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
950164676 3:10785229-10785251 TTGTGTTTTTCAAGGGATGATGG - Intergenic
952043818 3:29293339-29293361 GTGTGGTTCTCATGGCAATACGG - Intronic
953397687 3:42586057-42586079 GTTTGGTTGTAAAGGGGAGAGGG - Intronic
953782431 3:45883500-45883522 GTCTGGTGATTAAGAGAAGATGG + Intronic
954231881 3:49224138-49224160 GGGTGGTTAACAACAGAAGAAGG - Intronic
954795464 3:53159487-53159509 GTGTGGTTCACCATGGAAGAAGG - Intronic
955710003 3:61768775-61768797 GTGTGTTTGCCCAGGGAAGAGGG + Intronic
957119995 3:76077892-76077914 GAATGGTTATCAATGGAAGTTGG - Intronic
960452362 3:117826358-117826380 GTGTGGTTATCATTGGGGGAGGG - Intergenic
960504486 3:118476430-118476452 GTGTGGTTATCCTTGGAGGAAGG + Intergenic
961341477 3:126224935-126224957 CGGTGGTGACCAAGGGAAGAAGG + Intergenic
961778761 3:129308847-129308869 TGGTGGTTATCAAGGGCTGAGGG - Intergenic
963849196 3:150192920-150192942 TTGTTGTTTTGAAGGGAAGAGGG + Intergenic
966098275 3:176232972-176232994 CAGTGGTTACCAAGGGTAGAAGG + Intergenic
966776974 3:183551181-183551203 ATGTGCTTATCAGGGTAAGATGG + Intronic
966811941 3:183854560-183854582 TGGTGGTTATCAAGGGATGAAGG + Intronic
970816400 4:20161278-20161300 GAGTGGTTATCTACAGAAGATGG - Intergenic
971229978 4:24793830-24793852 ATGTTGTTACCAAAGGAAGAGGG + Intronic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973106530 4:46345352-46345374 TTGTGATTGTCAAGGGAATATGG - Intronic
974642147 4:64645060-64645082 GGGTGGAAATAAAGGGAAGATGG - Intergenic
974709767 4:65575315-65575337 GTTTGGACATCAAGTGAAGAAGG - Intronic
975177153 4:71301215-71301237 GTGTAGTTAGCAAGGGGAGTGGG + Intronic
975361975 4:73481002-73481024 TGGTGGTTATCAAGGGCAGGAGG - Intergenic
977118498 4:93065823-93065845 GTGTATTTAGCAAGGGCAGATGG - Intronic
978745033 4:112183475-112183497 GTGGGTTTTTCAGGGGAAGAAGG - Intronic
979175282 4:117655301-117655323 TGGTGGTTATCAAGGGCTGATGG + Intergenic
980771176 4:137375238-137375260 GTTTGGTTAGCCAGGGAAGAAGG + Intergenic
980967779 4:139539854-139539876 GTGAGGATATCAGGAGAAGATGG + Intronic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
982866800 4:160523481-160523503 GTGTGGAAATAAAGGGTAGATGG + Intergenic
983690905 4:170467865-170467887 GTGCCCTTATCAAGGAAAGAAGG + Intergenic
984410460 4:179391172-179391194 GAGTTGTTATCCAGAGAAGAAGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987261906 5:16212871-16212893 GAGTGGTTTTCAATTGAAGAAGG - Intergenic
988188292 5:27896928-27896950 GGGTGGTTACAAATGGAAGAGGG + Intergenic
988963694 5:36393925-36393947 CAGTGGTTTTCAAGAGAAGAGGG - Intergenic
990027903 5:51218171-51218193 GGCTGGTTACCAAGAGAAGAGGG + Intergenic
992122616 5:73610257-73610279 CTGTGGTTATCAGGGGGAGCTGG - Intergenic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
994374405 5:99002822-99002844 GTTTGGCTATAAAGGGGAGAAGG + Intergenic
997167738 5:131679313-131679335 GTGTTGTTGACAAGGAAAGAAGG - Intronic
998713404 5:144851257-144851279 GGGTGGTTAACAACAGAAGAAGG - Intergenic
999585834 5:153088640-153088662 GTGTGGAAATGAAGGGTAGATGG + Intergenic
1000094435 5:157958764-157958786 GTGTTCTTATAAAGGAAAGAGGG + Intergenic
1001874542 5:175188122-175188144 GTGTTGTTCTCAAGAGAAGGAGG + Intergenic
1001929957 5:175665778-175665800 GAGTGGTTAGAAAAGGAAGAAGG + Intronic
1003624329 6:7727994-7728016 GTGTGGCCATCCTGGGAAGAGGG + Intronic
1005571383 6:27148691-27148713 AGGTAGTTATCAGGGGAAGAGGG - Intergenic
1005784673 6:29231046-29231068 GAGTGGTGATCAGGGTAAGAAGG + Intergenic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1008470809 6:51882184-51882206 GTGTAGTTTTCAAGAGAGGATGG - Intronic
1011484088 6:87824135-87824157 GTGTGCTGATAAAGGGAAGCAGG + Intergenic
1012170893 6:96015877-96015899 GGGGGGTGAGCAAGGGAAGAGGG - Intergenic
1012405792 6:98896271-98896293 GTGTGTGTATCAAAGGAAGAAGG + Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014596783 6:123353633-123353655 GTGTAATTAAGAAGGGAAGAAGG + Intronic
1015696617 6:135987525-135987547 GTGTTATTCTGAAGGGAAGAAGG - Intronic
1017528260 6:155262094-155262116 CTGTGGTCATCAGGGAAAGAGGG + Intronic
1018184716 6:161256580-161256602 GTGTGGCTATCAGAGGAAGCTGG - Intronic
1018571653 6:165217524-165217546 ATCTGGTTTTCAAAGGAAGAGGG - Intergenic
1019039701 6:169093698-169093720 GTGTTGTTGTGAAGGGCAGATGG - Intergenic
1019633582 7:2063726-2063748 GTGTGGTGCCCACGGGAAGAGGG - Intronic
1020040911 7:5000207-5000229 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
1023305549 7:38822567-38822589 AAGTGGTCATCAATGGAAGATGG - Intronic
1024509186 7:50189794-50189816 GTTTCATTATCCAGGGAAGATGG + Intergenic
1026641583 7:72131001-72131023 GTGTGATTGTCAAAGGAAGAGGG - Intronic
1027499305 7:78928246-78928268 GTGTACTTATCAAAGGCAGATGG + Intronic
1027505501 7:79012885-79012907 GTGTGGATATAATGAGAAGATGG - Intronic
1028931179 7:96414791-96414813 GTGTGGGTGTCAAGGTGAGAGGG + Intergenic
1029478865 7:100801203-100801225 GTCTGGTTGGCAGGGGAAGAGGG + Intergenic
1029641754 7:101825188-101825210 GTGTGAATAGGAAGGGAAGATGG - Intronic
1031144253 7:117980183-117980205 ATTTGGTTTTCAAGGGATGAAGG + Intergenic
1031574107 7:123394830-123394852 CTGTGGATAACAATGGAAGATGG + Intergenic
1035130689 7:156650451-156650473 GTGGGGTTCTAAAGGCAAGATGG + Intronic
1035561431 8:607106-607128 TTCTGGTTTTCAAGTGAAGACGG + Intergenic
1036918566 8:12829877-12829899 GTGTGGTTACCAGGGCAAGGCGG - Intergenic
1037052450 8:14393385-14393407 ATGTGGTTGACAAGGGAAGATGG - Intronic
1038002871 8:23405307-23405329 GTGTAGTTATCAAAGGCAGGAGG + Intronic
1040508630 8:48074115-48074137 GTGTGGTTTCCATGGGCAGAAGG - Intergenic
1040796401 8:51293684-51293706 GGGTGGTTAACAACAGAAGAGGG - Intergenic
1040946541 8:52891195-52891217 TTGTGGTTATCAAGAGAGAAAGG - Intergenic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1042268699 8:66934890-66934912 GTGTGGTTATCAAGGGGGTAGGG - Intergenic
1042772347 8:72393540-72393562 GGGTGGTTAACAACAGAAGAGGG + Intergenic
1042998848 8:74732732-74732754 ATGTGACTATCAAGGGAGGAGGG + Intronic
1043149704 8:76699594-76699616 GTGTGCTAACCAAGAGAAGAGGG - Intronic
1047343628 8:124006233-124006255 GTGGGGGTTTCAGGGGAAGATGG + Intronic
1048760769 8:137792634-137792656 GTTTTGTTAGCAAGGGAAGAGGG - Intergenic
1049090232 8:140509175-140509197 GTGTGGTTACCAAGGTAGGTGGG - Intergenic
1053121513 9:35550693-35550715 GTTGAGTTATAAAGGGAAGAAGG + Intronic
1053472655 9:38357963-38357985 GTGTGGTTATGAAGGTGGGAGGG + Intergenic
1056392339 9:86151708-86151730 GGGTGGTTAACAACAGAAGAAGG - Intergenic
1057268515 9:93634217-93634239 GTGTGGATATCAAGGGAGCAAGG - Intronic
1057648209 9:96896895-96896917 GAGTAGTTATCAGCGGAAGATGG - Intergenic
1057836852 9:98452100-98452122 GTGTGGATGCCAAGGTAAGATGG - Intronic
1058092142 9:100816459-100816481 GGATGGTTACCAAGGGCAGATGG - Intergenic
1059611482 9:115902042-115902064 GGGTGATTATCTAGGGAAGACGG + Intergenic
1059934108 9:119290668-119290690 GTGTGATTACCCAGGGAAAATGG + Intronic
1060485560 9:124044336-124044358 GAGAGGTTATCAAGAGAAGTGGG + Intergenic
1060609955 9:124954777-124954799 GCGTGGTTATCCAGGGCTGAGGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1062283932 9:135764790-135764812 GTGTGGGGACCAAGGGAGGAGGG - Intronic
1203769550 EBV:41942-41964 ATCAGGTTAACAAGGGAAGAAGG - Intergenic
1186310297 X:8310301-8310323 GTGTGTTTATGTGGGGAAGAAGG + Intergenic
1189579304 X:42388929-42388951 GTGGGGTTGGGAAGGGAAGATGG + Intergenic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1195228466 X:102822243-102822265 GAGTAGTTATCTAGGAAAGATGG - Intergenic
1198329555 X:135609349-135609371 ATATTGTCATCAAGGGAAGAAGG + Intergenic
1198329909 X:135612756-135612778 ATAGTGTTATCAAGGGAAGAAGG + Intergenic
1200287859 X:154840903-154840925 ATGAGGTTTTCAAGGAAAGAGGG + Intronic
1200942953 Y:8804487-8804509 GTGTGGTTATCTGGTGAAGGTGG - Intergenic
1201311649 Y:12603132-12603154 GGGTGGTTAACAACAGAAGAGGG - Intergenic
1201907882 Y:19103917-19103939 GGGTGGTTAGCAACAGAAGAGGG - Intergenic
1202025333 Y:20516666-20516688 GTTTAGTTATTAAAGGAAGAGGG - Intergenic