ID: 1079646822

View in Genome Browser
Species Human (GRCh38)
Location 11:22874133-22874155
Sequence TCTAACACGCAAAACCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079646822_1079646826 5 Left 1079646822 11:22874133-22874155 CCTACCTGGTTTTGCGTGTTAGA No data
Right 1079646826 11:22874161-22874183 CACATGGAAACAGATTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079646822 Original CRISPR TCTAACACGCAAAACCAGGT AGG (reversed) Intergenic
No off target data available for this crispr