ID: 1079651454

View in Genome Browser
Species Human (GRCh38)
Location 11:22934973-22934995
Sequence CACTTCCCCATTTAGATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079651454_1079651455 7 Left 1079651454 11:22934973-22934995 CCATATATCTAAATGGGGAAGTG No data
Right 1079651455 11:22935003-22935025 CTAAGAAACTAATAAAATACAGG No data
1079651454_1079651456 12 Left 1079651454 11:22934973-22934995 CCATATATCTAAATGGGGAAGTG No data
Right 1079651456 11:22935008-22935030 AAACTAATAAAATACAGGCGAGG No data
1079651454_1079651457 20 Left 1079651454 11:22934973-22934995 CCATATATCTAAATGGGGAAGTG No data
Right 1079651457 11:22935016-22935038 AAAATACAGGCGAGGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079651454 Original CRISPR CACTTCCCCATTTAGATATA TGG (reversed) Intergenic
No off target data available for this crispr