ID: 1079658578

View in Genome Browser
Species Human (GRCh38)
Location 11:23012937-23012959
Sequence CTTCTTTTATTCAGAGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079658576_1079658578 -5 Left 1079658576 11:23012919-23012941 CCAGTATAAAATGTATGCCTTCT No data
Right 1079658578 11:23012937-23012959 CTTCTTTTATTCAGAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079658578 Original CRISPR CTTCTTTTATTCAGAGCAAA AGG Intergenic
No off target data available for this crispr