ID: 1079663973

View in Genome Browser
Species Human (GRCh38)
Location 11:23080575-23080597
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079663967_1079663973 16 Left 1079663967 11:23080536-23080558 CCAAGAGCATGGTGCTGGCATCT 0: 32
1: 74
2: 224
3: 411
4: 1150
Right 1079663973 11:23080575-23080597 CTGTACTAGTACATGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079663973 Original CRISPR CTGTACTAGTACATGGCAGA GGG Intergenic
No off target data available for this crispr