ID: 1079666212

View in Genome Browser
Species Human (GRCh38)
Location 11:23109202-23109224
Sequence ATAGAGAAGGAGGTTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079666207_1079666212 -7 Left 1079666207 11:23109186-23109208 CCAGAAGGCACCAAAGATAGAGA No data
Right 1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079666212 Original CRISPR ATAGAGAAGGAGGTTGGAGA TGG Intergenic
No off target data available for this crispr