ID: 1079673619

View in Genome Browser
Species Human (GRCh38)
Location 11:23198861-23198883
Sequence CTCAGTAGGTACTCTGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079673612_1079673619 6 Left 1079673612 11:23198832-23198854 CCTCTTCTCACAGCTCCACTAGG 0: 1581
1: 2034
2: 1486
3: 837
4: 562
Right 1079673619 11:23198861-23198883 CTCAGTAGGTACTCTGTGTGGGG No data
1079673614_1079673619 -9 Left 1079673614 11:23198847-23198869 CCACTAGGCACTGCCTCAGTAGG No data
Right 1079673619 11:23198861-23198883 CTCAGTAGGTACTCTGTGTGGGG No data
1079673611_1079673619 7 Left 1079673611 11:23198831-23198853 CCCTCTTCTCACAGCTCCACTAG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
Right 1079673619 11:23198861-23198883 CTCAGTAGGTACTCTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079673619 Original CRISPR CTCAGTAGGTACTCTGTGTG GGG Intergenic
No off target data available for this crispr