ID: 1079688405

View in Genome Browser
Species Human (GRCh38)
Location 11:23391734-23391756
Sequence CACCCATGGCTGAGTACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079688400_1079688405 5 Left 1079688400 11:23391706-23391728 CCTGGAGATAAATTTCACATTTT No data
Right 1079688405 11:23391734-23391756 CACCCATGGCTGAGTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079688405 Original CRISPR CACCCATGGCTGAGTACTTC TGG Intergenic
No off target data available for this crispr