ID: 1079691133

View in Genome Browser
Species Human (GRCh38)
Location 11:23418432-23418454
Sequence GTGTGCATGTGAATGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079691133_1079691134 23 Left 1079691133 11:23418432-23418454 CCAGGACACATTCACATGCACAC No data
Right 1079691134 11:23418478-23418500 AATTACAAATATCGTTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079691133 Original CRISPR GTGTGCATGTGAATGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr