ID: 1079698691

View in Genome Browser
Species Human (GRCh38)
Location 11:23517529-23517551
Sequence CCCAGTGACAGCATGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079698691_1079698696 8 Left 1079698691 11:23517529-23517551 CCCTGCATCATGCTGTCACTGGG No data
Right 1079698696 11:23517560-23517582 TTTTTTGTTCTTTTTTTAAGGGG No data
1079698691_1079698694 6 Left 1079698691 11:23517529-23517551 CCCTGCATCATGCTGTCACTGGG No data
Right 1079698694 11:23517558-23517580 GTTTTTTTGTTCTTTTTTTAAGG No data
1079698691_1079698695 7 Left 1079698691 11:23517529-23517551 CCCTGCATCATGCTGTCACTGGG No data
Right 1079698695 11:23517559-23517581 TTTTTTTGTTCTTTTTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079698691 Original CRISPR CCCAGTGACAGCATGATGCA GGG (reversed) Intergenic
No off target data available for this crispr