ID: 1079699562

View in Genome Browser
Species Human (GRCh38)
Location 11:23526987-23527009
Sequence GGATATAAGGGTCTTTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079699562_1079699567 -10 Left 1079699562 11:23526987-23527009 CCCTAAAAAAGACCCTTATATCC No data
Right 1079699567 11:23527000-23527022 CCTTATATCCTGTAGCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079699562 Original CRISPR GGATATAAGGGTCTTTTTTA GGG (reversed) Intergenic
No off target data available for this crispr