ID: 1079707443

View in Genome Browser
Species Human (GRCh38)
Location 11:23638295-23638317
Sequence CAAATTGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079707443_1079707446 4 Left 1079707443 11:23638295-23638317 CCCATATCACTATCAGCAATTTG No data
Right 1079707446 11:23638322-23638344 CAATCATTCAACAAGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079707443 Original CRISPR CAAATTGCTGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr