ID: 1079724568

View in Genome Browser
Species Human (GRCh38)
Location 11:23865126-23865148
Sequence CAGAAGAAGGAAAAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079724568_1079724572 6 Left 1079724568 11:23865126-23865148 CCCTACTCCTTTTCCTTCTTCTG No data
Right 1079724572 11:23865155-23865177 CACTGCCTTTTTCTCTCCAGTGG No data
1079724568_1079724574 19 Left 1079724568 11:23865126-23865148 CCCTACTCCTTTTCCTTCTTCTG No data
Right 1079724574 11:23865168-23865190 TCTCCAGTGGAGAGATTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079724568 Original CRISPR CAGAAGAAGGAAAAGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr