ID: 1079724827

View in Genome Browser
Species Human (GRCh38)
Location 11:23867780-23867802
Sequence TAGGGCCAGCAGACTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079724827_1079724833 16 Left 1079724827 11:23867780-23867802 CCCACCTCAGTCTGCTGGCCCTA No data
Right 1079724833 11:23867819-23867841 ATATGTCAAAGAAATCTATTTGG No data
1079724827_1079724834 19 Left 1079724827 11:23867780-23867802 CCCACCTCAGTCTGCTGGCCCTA No data
Right 1079724834 11:23867822-23867844 TGTCAAAGAAATCTATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079724827 Original CRISPR TAGGGCCAGCAGACTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr