ID: 1079730892

View in Genome Browser
Species Human (GRCh38)
Location 11:23937108-23937130
Sequence TCTAGTCGAATGGGAACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079730892_1079730899 20 Left 1079730892 11:23937108-23937130 CCTCTGGTTCCCATTCGACTAGA No data
Right 1079730899 11:23937151-23937173 TTCCTTGATTAGAGTATAGAGGG No data
1079730892_1079730895 -5 Left 1079730892 11:23937108-23937130 CCTCTGGTTCCCATTCGACTAGA No data
Right 1079730895 11:23937126-23937148 CTAGATGAGTATTTGCCTTCTGG No data
1079730892_1079730900 21 Left 1079730892 11:23937108-23937130 CCTCTGGTTCCCATTCGACTAGA No data
Right 1079730900 11:23937152-23937174 TCCTTGATTAGAGTATAGAGGGG No data
1079730892_1079730896 -4 Left 1079730892 11:23937108-23937130 CCTCTGGTTCCCATTCGACTAGA No data
Right 1079730896 11:23937127-23937149 TAGATGAGTATTTGCCTTCTGGG No data
1079730892_1079730898 19 Left 1079730892 11:23937108-23937130 CCTCTGGTTCCCATTCGACTAGA No data
Right 1079730898 11:23937150-23937172 TTTCCTTGATTAGAGTATAGAGG No data
1079730892_1079730902 26 Left 1079730892 11:23937108-23937130 CCTCTGGTTCCCATTCGACTAGA No data
Right 1079730902 11:23937157-23937179 GATTAGAGTATAGAGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079730892 Original CRISPR TCTAGTCGAATGGGAACCAG AGG (reversed) Intergenic