ID: 1079731538

View in Genome Browser
Species Human (GRCh38)
Location 11:23941173-23941195
Sequence CAGACTAAAGACACGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079731538_1079731543 12 Left 1079731538 11:23941173-23941195 CCTGCAACCGTGTCTTTAGTCTG No data
Right 1079731543 11:23941208-23941230 GTTGCTTTTAACTGGCTGACAGG 0: 16
1: 31
2: 71
3: 110
4: 149
1079731538_1079731542 4 Left 1079731538 11:23941173-23941195 CCTGCAACCGTGTCTTTAGTCTG No data
Right 1079731542 11:23941200-23941222 CTGCGCTAGTTGCTTTTAACTGG No data
1079731538_1079731544 19 Left 1079731538 11:23941173-23941195 CCTGCAACCGTGTCTTTAGTCTG No data
Right 1079731544 11:23941215-23941237 TTAACTGGCTGACAGGTGCCCGG 0: 31
1: 85
2: 89
3: 58
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079731538 Original CRISPR CAGACTAAAGACACGGTTGC AGG (reversed) Intergenic
No off target data available for this crispr