ID: 1079738258

View in Genome Browser
Species Human (GRCh38)
Location 11:24024930-24024952
Sequence AGTCCCTCCTTTACAGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079738258_1079738261 0 Left 1079738258 11:24024930-24024952 CCCACAACTGTAAAGGAGGGACT No data
Right 1079738261 11:24024953-24024975 CCTCCCTTACTCATTTTATGAGG 0: 24
1: 8671
2: 4336
3: 2089
4: 1748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079738258 Original CRISPR AGTCCCTCCTTTACAGTTGT GGG (reversed) Intergenic
No off target data available for this crispr