ID: 1079743930

View in Genome Browser
Species Human (GRCh38)
Location 11:24101252-24101274
Sequence CACTGTGACCTGAGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079743930_1079743934 7 Left 1079743930 11:24101252-24101274 CCTGCTCCCCTCAGGTCACAGTG No data
Right 1079743934 11:24101282-24101304 GACCTCTCCACTCCACCCTCAGG No data
1079743930_1079743938 19 Left 1079743930 11:24101252-24101274 CCTGCTCCCCTCAGGTCACAGTG No data
Right 1079743938 11:24101294-24101316 CCACCCTCAGGCAGCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079743930 Original CRISPR CACTGTGACCTGAGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr