ID: 1079744807

View in Genome Browser
Species Human (GRCh38)
Location 11:24111659-24111681
Sequence CAGAGTGAAGTTAATATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079744807_1079744808 -1 Left 1079744807 11:24111659-24111681 CCTATTATATTAACTTCACTCTG No data
Right 1079744808 11:24111681-24111703 GTCCTGTTAGAGTTTTCTCAAGG No data
1079744807_1079744810 2 Left 1079744807 11:24111659-24111681 CCTATTATATTAACTTCACTCTG No data
Right 1079744810 11:24111684-24111706 CTGTTAGAGTTTTCTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079744807 Original CRISPR CAGAGTGAAGTTAATATAAT AGG (reversed) Intergenic
No off target data available for this crispr