ID: 1079747327

View in Genome Browser
Species Human (GRCh38)
Location 11:24150134-24150156
Sequence GCCTGGTCACATCCTCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079747327_1079747341 30 Left 1079747327 11:24150134-24150156 CCCCTAAGAGGATGTGACCAGGC No data
Right 1079747341 11:24150187-24150209 AAACTCGTGCTGTGCTGGAGGGG No data
1079747327_1079747339 28 Left 1079747327 11:24150134-24150156 CCCCTAAGAGGATGTGACCAGGC No data
Right 1079747339 11:24150185-24150207 TTAAACTCGTGCTGTGCTGGAGG No data
1079747327_1079747331 -5 Left 1079747327 11:24150134-24150156 CCCCTAAGAGGATGTGACCAGGC No data
Right 1079747331 11:24150152-24150174 CAGGCCTGCAGCTCTTTTCCTGG No data
1079747327_1079747333 5 Left 1079747327 11:24150134-24150156 CCCCTAAGAGGATGTGACCAGGC No data
Right 1079747333 11:24150162-24150184 GCTCTTTTCCTGGCCCCTCAAGG No data
1079747327_1079747340 29 Left 1079747327 11:24150134-24150156 CCCCTAAGAGGATGTGACCAGGC No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747327_1079747338 25 Left 1079747327 11:24150134-24150156 CCCCTAAGAGGATGTGACCAGGC No data
Right 1079747338 11:24150182-24150204 AGGTTAAACTCGTGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079747327 Original CRISPR GCCTGGTCACATCCTCTTAG GGG (reversed) Intergenic