ID: 1079747328

View in Genome Browser
Species Human (GRCh38)
Location 11:24150135-24150157
Sequence GGCCTGGTCACATCCTCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079747328_1079747338 24 Left 1079747328 11:24150135-24150157 CCCTAAGAGGATGTGACCAGGCC No data
Right 1079747338 11:24150182-24150204 AGGTTAAACTCGTGCTGTGCTGG No data
1079747328_1079747340 28 Left 1079747328 11:24150135-24150157 CCCTAAGAGGATGTGACCAGGCC No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747328_1079747333 4 Left 1079747328 11:24150135-24150157 CCCTAAGAGGATGTGACCAGGCC No data
Right 1079747333 11:24150162-24150184 GCTCTTTTCCTGGCCCCTCAAGG No data
1079747328_1079747339 27 Left 1079747328 11:24150135-24150157 CCCTAAGAGGATGTGACCAGGCC No data
Right 1079747339 11:24150185-24150207 TTAAACTCGTGCTGTGCTGGAGG No data
1079747328_1079747331 -6 Left 1079747328 11:24150135-24150157 CCCTAAGAGGATGTGACCAGGCC No data
Right 1079747331 11:24150152-24150174 CAGGCCTGCAGCTCTTTTCCTGG No data
1079747328_1079747341 29 Left 1079747328 11:24150135-24150157 CCCTAAGAGGATGTGACCAGGCC No data
Right 1079747341 11:24150187-24150209 AAACTCGTGCTGTGCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079747328 Original CRISPR GGCCTGGTCACATCCTCTTA GGG (reversed) Intergenic
No off target data available for this crispr