ID: 1079747330

View in Genome Browser
Species Human (GRCh38)
Location 11:24150151-24150173
Sequence CAGGAAAAGAGCTGCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079747330_1079747341 13 Left 1079747330 11:24150151-24150173 CCAGGCCTGCAGCTCTTTTCCTG No data
Right 1079747341 11:24150187-24150209 AAACTCGTGCTGTGCTGGAGGGG No data
1079747330_1079747339 11 Left 1079747330 11:24150151-24150173 CCAGGCCTGCAGCTCTTTTCCTG No data
Right 1079747339 11:24150185-24150207 TTAAACTCGTGCTGTGCTGGAGG No data
1079747330_1079747340 12 Left 1079747330 11:24150151-24150173 CCAGGCCTGCAGCTCTTTTCCTG No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747330_1079747342 19 Left 1079747330 11:24150151-24150173 CCAGGCCTGCAGCTCTTTTCCTG No data
Right 1079747342 11:24150193-24150215 GTGCTGTGCTGGAGGGGCTGAGG No data
1079747330_1079747338 8 Left 1079747330 11:24150151-24150173 CCAGGCCTGCAGCTCTTTTCCTG No data
Right 1079747338 11:24150182-24150204 AGGTTAAACTCGTGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079747330 Original CRISPR CAGGAAAAGAGCTGCAGGCC TGG (reversed) Intergenic
No off target data available for this crispr