ID: 1079747331

View in Genome Browser
Species Human (GRCh38)
Location 11:24150152-24150174
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079747327_1079747331 -5 Left 1079747327 11:24150134-24150156 CCCCTAAGAGGATGTGACCAGGC No data
Right 1079747331 11:24150152-24150174 CAGGCCTGCAGCTCTTTTCCTGG No data
1079747328_1079747331 -6 Left 1079747328 11:24150135-24150157 CCCTAAGAGGATGTGACCAGGCC No data
Right 1079747331 11:24150152-24150174 CAGGCCTGCAGCTCTTTTCCTGG No data
1079747329_1079747331 -7 Left 1079747329 11:24150136-24150158 CCTAAGAGGATGTGACCAGGCCT No data
Right 1079747331 11:24150152-24150174 CAGGCCTGCAGCTCTTTTCCTGG No data
1079747323_1079747331 13 Left 1079747323 11:24150116-24150138 CCTTAGCTTCCTGATCTACCCCT No data
Right 1079747331 11:24150152-24150174 CAGGCCTGCAGCTCTTTTCCTGG No data
1079747325_1079747331 4 Left 1079747325 11:24150125-24150147 CCTGATCTACCCCTAAGAGGATG No data
Right 1079747331 11:24150152-24150174 CAGGCCTGCAGCTCTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079747331 Original CRISPR CAGGCCTGCAGCTCTTTTCC TGG Intergenic
No off target data available for this crispr