ID: 1079747334

View in Genome Browser
Species Human (GRCh38)
Location 11:24150170-24150192
Sequence GAGTTTAACCTTGAGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079747334_1079747340 -7 Left 1079747334 11:24150170-24150192 CCTGGCCCCTCAAGGTTAAACTC No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747334_1079747341 -6 Left 1079747334 11:24150170-24150192 CCTGGCCCCTCAAGGTTAAACTC No data
Right 1079747341 11:24150187-24150209 AAACTCGTGCTGTGCTGGAGGGG No data
1079747334_1079747339 -8 Left 1079747334 11:24150170-24150192 CCTGGCCCCTCAAGGTTAAACTC No data
Right 1079747339 11:24150185-24150207 TTAAACTCGTGCTGTGCTGGAGG No data
1079747334_1079747342 0 Left 1079747334 11:24150170-24150192 CCTGGCCCCTCAAGGTTAAACTC No data
Right 1079747342 11:24150193-24150215 GTGCTGTGCTGGAGGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079747334 Original CRISPR GAGTTTAACCTTGAGGGGCC AGG (reversed) Intergenic
No off target data available for this crispr