ID: 1079747340

View in Genome Browser
Species Human (GRCh38)
Location 11:24150186-24150208
Sequence TAAACTCGTGCTGTGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079747328_1079747340 28 Left 1079747328 11:24150135-24150157 CCCTAAGAGGATGTGACCAGGCC No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747334_1079747340 -7 Left 1079747334 11:24150170-24150192 CCTGGCCCCTCAAGGTTAAACTC No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747327_1079747340 29 Left 1079747327 11:24150134-24150156 CCCCTAAGAGGATGTGACCAGGC No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747329_1079747340 27 Left 1079747329 11:24150136-24150158 CCTAAGAGGATGTGACCAGGCCT No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747332_1079747340 7 Left 1079747332 11:24150156-24150178 CCTGCAGCTCTTTTCCTGGCCCC No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data
1079747330_1079747340 12 Left 1079747330 11:24150151-24150173 CCAGGCCTGCAGCTCTTTTCCTG No data
Right 1079747340 11:24150186-24150208 TAAACTCGTGCTGTGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079747340 Original CRISPR TAAACTCGTGCTGTGCTGGA GGG Intergenic
No off target data available for this crispr