ID: 1079750685

View in Genome Browser
Species Human (GRCh38)
Location 11:24192325-24192347
Sequence CATGAGAGGGACTCCGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079750685_1079750691 14 Left 1079750685 11:24192325-24192347 CCTCCCACGGAGTCCCTCTCATG No data
Right 1079750691 11:24192362-24192384 CTACAGTTCAAGGTGAGATTTGG 0: 24
1: 735
2: 6075
3: 9138
4: 9415
1079750685_1079750690 4 Left 1079750685 11:24192325-24192347 CCTCCCACGGAGTCCCTCTCATG No data
Right 1079750690 11:24192352-24192374 ATGATGATTACTACAGTTCAAGG No data
1079750685_1079750693 19 Left 1079750685 11:24192325-24192347 CCTCCCACGGAGTCCCTCTCATG No data
Right 1079750693 11:24192367-24192389 GTTCAAGGTGAGATTTGGATGGG No data
1079750685_1079750692 18 Left 1079750685 11:24192325-24192347 CCTCCCACGGAGTCCCTCTCATG No data
Right 1079750692 11:24192366-24192388 AGTTCAAGGTGAGATTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079750685 Original CRISPR CATGAGAGGGACTCCGTGGG AGG (reversed) Intergenic
No off target data available for this crispr